Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59C6.9   

sjj_F59C6.9RNAiJA:F59C6.9
PCR_productsjj_F59C6.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59C6.7 Source_evidenceePCR770WS150 Sequence/Annotation Release
Overlaps_Gene F59C6.7 Source_evidenceePCR770WS150 Sequence/Annotation Release
Chunk_score Abs_score646
Max_abs_score646F59C6.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1050719210508275
Overlaps_transcriptF59C6.7 Source_evidenceePCR770WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59C6.91084tccaatttgctcactgcttgcttaatcttcacaagtggtgctccgtcacttgattttgctccctgttcctcaatctgttgcttcaattgttcaatgtcatcactgatacgatcgagagtttcagttcgagaactcacgccaacagaagctgctctaaaaccaataaaattgtgttttttgaaaagtgtgttttttattcaaaaattgttaattctgaaaactaacttatatttctctctcaactcggctcttgtgtcggttgctcgccggaatttgctcatcatacttgccaattgactgttcagtgatttttcccttgatgcgatccgttccagagcttttgcaatatctttggacatctgaatttcgatgaaaaaattataaaatttcagaggttcgataattcaatttaatttaatttgaatccccacgcattcacgagcgtacaatagatcttttcatttttgtagacgtagacataattgagaaaatatacttacattatcgagataaggaccaacgtttccaactttttgctcaacatttttgtgcattgagttcatctgttcaagatgaagacgccaatcttttgcatcctgtttcaatgtaattttcaattgtggagcaactctttcaacttcttgtttccaagttattgcatccgtattgctttggagaacgctttggagtggattcttctgaaactcatcaaaattcaaagtcttatttctcgttaaactaaccgattcagtcgccaatccctgagctttcaaatcaatttcaataacattgtcatcatcatcatcatccaaaaagttcattggttcttcaacaatatcatcgttatcatcatcttcatcttgctcatccactgcagtatcttcgtcttcttcttttggaggaatcattctgaaataaaaaacaattttttttgtttttatttcgacaagagtcatacttctgccactgaaatcctacatgaacaagtgaggcatcagccagtgagttcagaatgaaaatcacattttctccagctccagactttagttttgctgcagtgaagtcagttgcgattccctgaaat