Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59E10.1   

sjj_F59E10.1 RNAi JA:F59E10.1
Simmer:F59E10.1:Repeat_a
Simmer:F59E10.1:Screen
PCR_productsjj_F59E10.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59E10.1 Source_evidenceePCR846WS150 Sequence/Annotation Release
Overlaps_Gene F59E10.1 Source_evidenceePCR849WS150 Sequence/Annotation Release
Chunk_score Abs_score786
Max_abs_score786F59E10.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII1087383610875390
Overlaps_transcriptF59E10.1 Source_evidenceePCR849WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59E10.11555aatttcagaaaatgccacggccaaaaattttgaaacgagcaactgtccagcccagtgccgccgttcctgtgaaaaaatcgactccagaaaaagaaggatccagacagaaaaagacgaatggaaaagagaatgcttctagaaatttgcaatcaaatttagaagaagatttggaacaactgggcttcgagtatgtatctattatccagatgaattcttgagcaaaaccgggtctcgacacggcaatttttgttgaaaacaaaacgggggtgcgtctataaggagtgctgtattatcacaatatgtgttcttaaaggcgcacagatctattcaggcgggtctctgcgcggaaaacagtatcgtagtattttctttttctttaaatttttccggttttttaatagaataatagaaggagaactaaatacaaaaaacggagtaatttcttgaaaaatgaaagtaaaaaactaccataaaatttaaaagtttttcgcgcgccgagactcatctgaatgattcggtgcgcctttaataatggtaggccaaaatttcgttgcggaatttccatcgatttttcattgttttttgttaaaattttttttaaataaacaaaaaactaggataattaaaagcgcatgaattttaacgaacaatcgataaaaattccacagtttgaaactacagtactctttaaaggcgcacacccgtttgtaattcaaaaaaaattgtcgtgccgagaccgggaattttggcgcaaaaattagaaaatcttccatctagctaaaaataagtacattttcgaagcaaatcaatcatttttccagggatgaaactgtatcaatggctcaatcagcaatcgaaaattactttatgcaaggaaaatcggcgtcagaacgaatgaataatgcgaaatcccgtcgtggaagacgtgctggaaatggaaatactgaagaaattgaggaagacgatgagatcagtaatgctatcactgatttcacaaaatgtgatctccctggacttcgaaattatattaccaaaaaagataacacggaattcgaaaaacgattggagcatctcgcggataatgatttcggaaaatggaagctttacctagcagctggatttaatattcttttgcacggtgtcggttcgaagcgtgatgttctcacagaatttgagaatgagctatccgattatacatatatgagagtggatgcacggaaagatgggctcaatgtaaaagttcttcttggagctatcaatgagaatatgaagctgaattgtaatgtgaagagaggccaatctacgattagttgggctcgatctattcgcagaaaaatgaatagccaacagttgattcttatcattgataatattgaagctcctgattggaggtgaggggaattcgcttttatttatgtataaaaaattaattttaattaatttcagaagtgatcaagaagcattttgcgaacttcttgagaatcgggattcggtgaaattgattgctacagttgatcacatttactcgacgttcatctggaattcggtgggtatc