Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_F59E11.5   

sjj_F59E11.5 RNAi (5)
PCR_productsjj_F59E11.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59E11.5 Source_evidenceePCR639WS150 Sequence/Annotation Release
Overlaps_Gene F59E11.5 Source_evidenceePCR720WS150 Sequence/Annotation Release
Chunk_score Abs_score616
Max_abs_score616F59E11.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV89974278998860
Overlaps_transcriptF59E11.5 Source_evidenceePCR720WS150 Sequence/Annotation Release
WB_DNA_textsjj_F59E11.51434tctgatcggcacaaaaataaactttacactttttatcacatgaccccaaatcaaaagttcaacccatcaattctatattttaaaaatcattttgtcagattcgatattgaaaaacaataaataatacgatattactgaaaacatttaacatacatttttatttaaagacagatgattttgatgtcaaatttgtttcatttatttccgcgttccaatttctttcaaggcctactcgttctcaaattttattttattttcagaatgaagagatcgagcaaattatgtttaatcataaacctttcatgttgtgcttgcattcttatcataattggttcaattgtggcaatttacatgttcggactgcaagctaaaatgccagatcctgggtactgtacgcggcagcatgcaacaattgcaatggaatgcgcaaaggtgggtttggaattgaggacaactcagggatctgaaaaataatgccaaagtaaatatgtactgtttctaattgatttttaaaaaattaattgaaaaaaaagaaaatgagaattgcgtacatctgcttcgtgcgaacactaggaagtaaaatgttcagaaagtaaggggtacgcaagcatgcctgtagccgtccaaaccacaaataccgtgaaaaatgaaaactatgctgctaaatttggaacatttgaaaagataatttttattctgtttgtcaagttaagcaattaacattttgcacctagatattcttttcagaaagacgacgaacttggtgcagctgccgctagtcttaatcacacacaattcctccttcaaagaccggaacattatgaatctctgggtggactttgctttgtcactctggtagatttaaccgtatctattcaaatttaatatttccctattttagcaatgtgcgcgagaaatcaagtgccgagcaatcagaaacattctaaatgacatcagcatctgtggatttatctattactacacaaaagagttttcagagtgtgcagaaaaactatacgtaaagagaaatgaaattccatgcattggagaaatttataatgaaaacaagagggtttgtcagatttattaaacctaaaattattaaaacaaacttttagactcctaaagaagcttgtcaaaagtggaagtcgatcaatccatgtgtgaaagaagccatccgaaatgaatgtgatgacaaacttggaatcctccagttcaaatgggagcaggtttgaagaaaaactgagaattctgaaatttacctatacgtttcagaaatcccacaaagccaacagtatttattgcgaggaagaccgaaggatcacatttggatctgaagagaatgaaaattaaatgttcttgatagtctctgattccctttctaattgaccggtaatagtattaattcgtttgtcagtaggatgttttgtggtg