Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H02I12.5   

sjj_H02I12.5 RNAi JA:H02I12.5
PF:GL1_6A2
PCR_productsjj_H02I12.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH02I12.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
Overlaps_Gene H02I12.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIV1140244111403584
Y62E10A.14 Chunk_score (3)
Y17G9B.9 Chunk_score (3)
Overlaps_transcriptH02I12.5 Source_evidenceePCR772WS150 Sequence/Annotation Release
WB_DNA_textsjj_H02I12.51144acgtgattgatgcagtcgaggccatcagtcggccttgtgaatcgagtcctggctcgagatttccgtattcccggcagtttgttgttcgcaggcgacgagtggtagtctgaaatatgaaaagttatcggtgtgaaatagaaaactattttacgtacactcttgctctgtgatcggatcaatgttgccaccacaaagctgtctgtcatctggaagccttcgatttccatctccagtttttcgagaattgcaaacaattgctggaacggcattgcagtctttgcctggatcgcaaatcgaaccacattttgacccgtctctttcggctcggccaggagggaagtctgaaataaaaaaatttttttgggaaaaatatactcaagaaactaactagaatcagactggagatatcttcggccgaaagcatgcggcactgagcggcgaaatagtgtggtcgctggttcggatgaaggagcacgtgctcgacaagcgctttctccgattctctggtcgtgttgaaccatctttgcgagaagaagtcgtagcgcttgagacggagattttcaatcggcattgtttgaatgtctcttagcactttgacagcttcatcgcggatgattgccttgctcggcttcttgtcgacgagctttggagtttcatcgatacgatgcagggaacggtagttcttatcctcgacgagctccacgtcttctccatgcccttcgataattgcatcatgattgatgttgggttgtggtgggagggctgagcaaccggctcgagcggtttccaattgatattcatcggtgtagttggccacgtatttggtcgccgtcaattcgcgaagaacggtacgggacggagctgacattctaaaaaacgttggtttgaaaaattaatggaaaaataagaattcgaagcaaaaattaaagataaaactttaaaaaaaacaatgtactcaagtgattaacagattaataatgcttcaccgataaaacaatatttatgaaatttcattacggctctctgaacatcagcaaagtagaagaatgttcacaatcaaaaattttcgttgggcctaaaataacacaattgttgcgctgacttttcgcgggggagatcgaataggtcaaataggcgatgcatt