Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H02I12.6   

sjj_H02I12.6RNAiSimmer:H02I12.6
PCR_productsjj_H02I12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH02I12.6 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene (6)
Overlaps_transcriptH02I12.6 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_textsjj_H02I12.6800ataatcgcaaaatttcgtctgaaactcatttaataccgtaaaagtgtgcaaacgcgctccgttggactttccaattctcgattttcttaactctcccgatttgaggcgctgtgcggtccagtaagaaaaagcctcatgacagcaaataacaagacaccataaacaaaatgagatttagtcaaaattaaaacgatttattgattatcaagtctataggattttaaagatttgtggccctaaagagggccgttgggttcggtggggtagttttcagcctaatggcttacttgctggaagtgtacttggtgacggccttggttccctcagacacggcgtgcttggcaagttctcctgggagaatcaaacggacagcggtttgaatttcgcgggatgagatcgttgagcgtttgttgtaatgagcaagacgggaagcttccgaagcgatgcgttcgaatacatcgttgacgaaggagttcatgatagacatggccttggaggagactccggtgtctgggtgaacttgcttgagaacacggtagatgtagacggagtacgattccttgcgggcatgacgtctcttctttccgtcctttggcttggcaacgacggtcttggcggccttcttggctcccttggcagatggctttggtggcatgatgagaatgaacttgaatcaagtatgaggaaatggttggagagacacctatttatgtaaaaactgcggtggaggggcggagcttcccgcggggacacattactgagtgcacacaaaattccgaatgtaccgaggttaatagggg