Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H02I12.6   

sjj_H02I12.6RNAiSimmer:H02I12.6
PCR_productsjj_H02I12.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH02I12.6 Source_evidenceePCR372WS150 Sequence/Annotation Release
Overlaps_Gene H02I12.6 Source_evidenceePCR372WS150 Sequence/Annotation Release
Chunk_score Abs_score330
Specificity_index0.247
Rel_score0.897
Map_statusUnique_ePCRIV1140010311400902
F54E12.4 Chunk_score Abs_score351
Specificity_index0.263
Rel_score0.954
F08G2.1 Chunk_score Abs_score86
Specificity_index0.064
Rel_score0.234
ZK131.5 Chunk_score Abs_score82
Specificity_index0.061
Rel_score0.223
B0035.8 Chunk_score Abs_score368
Max_abs_score368B0035.8
Specificity_index0.276
Rel_score1
F55G1.3 Chunk_score Abs_score118
Specificity_index0.088
Rel_score0.321
Overlaps_transcriptH02I12.6 Source_evidenceePCR372WS150 Sequence/Annotation Release
WB_DNA_textsjj_H02I12.6800ataatcgcaaaatttcgtctgaaactcatttaataccgtaaaagtgtgcaaacgcgctccgttggactttccaattctcgattttcttaactctcccgatttgaggcgctgtgcggtccagtaagaaaaagcctcatgacagcaaataacaagacaccataaacaaaatgagatttagtcaaaattaaaacgatttattgattatcaagtctataggattttaaagatttgtggccctaaagagggccgttgggttcggtggggtagttttcagcctaatggcttacttgctggaagtgtacttggtgacggccttggttccctcagacacggcgtgcttggcaagttctcctgggagaatcaaacggacagcggtttgaatttcgcgggatgagatcgttgagcgtttgttgtaatgagcaagacgggaagcttccgaagcgatgcgttcgaatacatcgttgacgaaggagttcatgatagacatggccttggaggagactccggtgtctgggtgaacttgcttgagaacacggtagatgtagacggagtacgattccttgcgggcatgacgtctcttctttccgtcctttggcttggcaacgacggtcttggcggccttcttggctcccttggcagatggctttggtggcatgatgagaatgaacttgaatcaagtatgaggaaatggttggagagacacctatttatgtaaaaactgcggtggaggggcggagcttcccgcggggacacattactgagtgcacacaaaattccgaatgtaccgaggttaatagggg