Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H02K04.1   

sjj_H02K04.1RNAiJA:H02K04.1
PCR_productsjj_H02K04.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H02K04.1 Source_evidenceePCR441WS150 Sequence/Annotation Release
H02K04.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
Overlaps_Gene H02K04.1 Source_evidenceePCR441WS150 Sequence/Annotation Release
Chunk_score Abs_score358
Specificity_index0.43
Rel_score0.755
Map_statusTop50_percentile_ePCRV1534105315343551
H02K04.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
Chunk_score Abs_score474
Max_abs_score474H02K04.2
Specificity_index0.57
Rel_score1
Map_statusBest_ePCRV1534105315343551
Overlaps_transcript H02K04.2 Source_evidenceePCR579WS150 Sequence/Annotation Release
H02K04.1 Source_evidenceePCR441WS150 Sequence/Annotation Release
WB_DNA_textsjj_H02K04.12499tgcaatcctggaactaaaacacttgtggcaatcttattaaaattgattttatctaacttgtgagaacagaaaaataaatataaataatttattcaattaacaaattaggctgcatattttccacaactgtacgccgttgtcgcatcacatgtaatatcattgtatcgtccacccatgtctttttccattgattgacaatcgccggtcccatcgtagaacggcataaagtcaccggcaagagcattgttcgtggacaccccattttgccattcatactgcaaacttttttttttaattgaaatttcaacgttcaaattcttaccggatctgtcgtggcacatggctcaactgcacatactctctttgcaccaatgagaacaaaattatacggggctatatcgacagtattcagatcgcctggaagttaagtaaaaatacaaattgcttcatccacgtgctcacttataaactgagttctttcagcagcagtctcaaacccattcaagaaggatccctgttgattatcctggcaatattgttgagctcccccggctccaaagccatcagccggaggtgttgcgattatatagcaccacaaaccatttgtacgttggaatgagaaccagccatcagggcatacaggctgtaaacaaagcttaagtagcgcagccgacacttcacaggtttcagagtggctaattttaaagcggggtcccgtgaaatgtcaactgcaggataagaaactgattattgacaaccgacatctctggaactaatagtagcagaatctttaaccaaaacctaccggtaatgttgtagttgtagtggttgtagtagttgtagtcgtcgtagttgtctccggcgggaccattggaatacaagcgctcacatgagaaattatccagaataaacaataaatcgaattcggatgaatcatcaggcaaacttgtaaaaacgccaatctacagatagttgtagatagaacggcaagattttggtaatcaaatggagaagaactgtgggatgcagtaaccagattacttatatggtctccaagccaaattgccgaattaagactttcaattgtttttctctaagtctatcgttttggtttttggaactttattatttcattttacaaaattagcattttggagactggggtccgaaaattattattattattatggaattattggtgataatttcaatattaaaaaaatcatttcgaattttcgtcaatattttttcacctgtccggtttggcccgtgagatgtccgccgctgttgcttcattactagtaggtagtactgtagatcacgggtgggcggccatttgaaaatctttcaaatttcaattaccgaaattttcaggcaaatgaacatttatataacttgccgttcatccctctatgaacgtgaatcttcatattgggaaacttgctggaactacttaaaaatcattttttgattttttgattccgacggaaatcaacatttcactcctcttatacaactttcaaacaacatcaaaccttgaatggaagcgcagactacattcattcaattcgacaatgaatgctaatgtattatggtcaaaccaaatgacgtaacactacgttcattagaaccagtaaccagatgtgtgtaggtgaaaaagggagacacggaaaagtttagaagaaactgataagtacagtaaatacaattgaaaaagcttgaaatttatgagaatcgtaagaaatttagcactaaaactatatgaagttaaaattccgaacaattaaaacataactttttaaataatttaaattatgatgcatatttcccacaactataagccgtcagcgcatcgcaggtaatatcattgtatcgtccaccctgaggcagttccattgaaacgcaatcacccgatccatcgtataacggcataaaatcattggcaagagcattgttagtggatactccatttagccattcgtactgcaaagaaggttccgcatttttaaaggtttttttcatgatgttttgttgtaaaaaacgttttttagtttcaatttcagaagtagtcaagtgaactagaaaagtctagtcaagtgccttaccggatctgtaactgcacacggtggcgctgcacatactctcattgcaccgatatgaacaaaattgtacggagccagattgacagtcatcacgtcatctgaaagcccgctgaaaattacaaacactcttccacgagctcactcaaaaactgagttctttcagcggcagtctcaaatccattcaagaaggatcccatttgattatcctgacaatattgttgaggactggtccagccagcagctggtggtcttgcaataatgtagcaccagaggccatttgcacgttgaaatgagaaccagccatcagggcacacaggctaaaagtaactggattacagcgcagccgatagtttataggtttctcggaggaaatttatgagagcaaaaagcgaagatc