Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H05L14.2   

sjj_H05L14.2 RNAi JA:H05L14.2
[cgc5655]:H05L14.2
PCR_productsjj_H05L14.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH05L14.2 Source_evidenceePCR889WS150 Sequence/Annotation Release
Overlaps_Gene H05L14.2 Source_evidenceePCR889WS150 Sequence/Annotation Release
Chunk_score Abs_score826
Max_abs_score826H05L14.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI79909777992153
Overlaps_transcriptH05L14.2 Source_evidenceePCR889WS150 Sequence/Annotation Release
WB_DNA_textsjj_H05L14.21177ctcctcatcccacagatggttattcaaatagatcaactcaatctgataactttgaaatgaatcaaatatgggatcttgagaaggaagtgattcgacaattgaaacgggataatataacttttgctgaatttatcaaatccgaagatgcacgtgaaatgtaagagtgtaattaaagaaatatgtttcaatatcatttagatttaggcatcagtttcttgctgacacattcaagaaaatggatttaaaatattttgcattcattctcgaaaaagcaatggtcgaatctcgtgaacaatcatggaaggatactattcagttgagattagctgcagaagaagctcatcttcaattggatttggctcgcggacagttcaagaaagaatttggtgacttgcgtgctcgaatggaaacaatttctcgttttgaaacatttgaagttcaagtttcgtctgaaagtagaattgagcagttacaaggacgtattgatgaactgattcgggagagaaataaccttgtaaaagaagaaatcaaggaagagaaagccttgatggaaaggcaaataaacgaaatgaaagccaagcatcttcaacagacacggtattaattttttccaaatcgattattaaaatttttctctaaatttaattttattccttgaaggattacaatatttttgttcaaataaattagtaaactggccaaactgatttgtaagaacattttgaaatgcatcccttatttcctaaaatttcacttaaattttgcataaaaagtataaatagctgactatgtaattcagcattatttatccacatttcaaaaaaattcagaattttaattgcaggaaaatggcagacgaaattcttcgcctgaagcaacaaagtgcacaattagcaactgccagagatgaattattgagaggaatctccgagctcgacaataattctcaaagaagtgctccgttgaatattcctgtgccgacagccaaagaatttcctcctctccatagaaatccccaaccagaaactgtaaccatctcaattgtatcttccaatatcgcttcgtgctcttcatctccttctccaccaacatctccaactcttccgatattatcagaagctcgccgccaactgaaattaactcaaaagttttctgcggaatttgatggcgatgagct