Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H06O01.2   

sjj_H06O01.2RNAiJA:H06O01.2
PCR_productsjj_H06O01.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH06O01.2 Source_evidenceePCR756WS150 Sequence/Annotation Release
Overlaps_Gene H06O01.2 Source_evidenceePCR756WS150 Sequence/Annotation Release
Chunk_score Abs_score714
Max_abs_score714H06O01.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI70133847014479
Overlaps_transcriptH06O01.2 Source_evidenceePCR756WS150 Sequence/Annotation Release
WB_DNA_textsjj_H06O01.21096tttgcaccaagcgtataccatccaattgagaccttcaagttgataatcacgaagtttgtgtgttgattctccgtcggttttcagaaaatccggcatcgactcaaatttttcaaatttcgggcgcttccggaggacctaaattattattttttgtagaggtttaataataaaaagtgaaataaattgtccttcaaactaacatttgaatttttattcggagatttcagattttcaattcgatgataataagcctttatctgctcaggtgcaaccatcttttcatcttcccaagtacaatccgagtacggtaatccagaccacttgataagatattcagttgccattgatccatcagcagctcgatctcttgatgtttgatgagctacgactctttccacttttttgtattcttcacaaagttcttctgccatttgttgttcacattcaaaaaattcaatgtattctttatcggctgaccgcttccacatctcaacttctttttgctttttcacgtagttttgaacttttttgagtccttttgcattcatcaaggccaatgagttttcagactcccatgtgttatgcagatgactccagcctgtccatttgacaaaaaattgctgctctgtcttatcaccgggaatttgatcgttaggatcccctttatcagcaatattataacaagttgttgcagaacccgttgctccaggtacaccgtgccgccatttgataactctttcgacagtttcagtaagaattgcaggtccttctgcgggtactgctggctcttcatcccattcaagaacgtcgtcatcgtcgatctggaaaaataaaatataggaaactgctaaattttaagattattttagttttagaaaaggtctttaaaatgaagttcggacgaaactagttccacattttagttttacgactcatacttaaaaaaattattaaatagctttaattttaagatgtttttaaattgaagctaataaatgaaggaaaaaataatttttgcggcctactgtatcaaaggcgcattactgaattacattttctaaaaatatttttcgcggagagaccactcggcgctata