Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H06O01.3   

sjj_H06O01.3RNAiJA:H06O01.3
PCR_productsjj_H06O01.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH06O01.3 Source_evidenceePCR741WS150 Sequence/Annotation Release
Overlaps_Gene H06O01.2 Source_evidenceePCR142WS150 Sequence/Annotation Release
Chunk_score Abs_score142
Specificity_index0.165
Rel_score0.197
Map_statusBottom50_percentile_ePCRI70077007009283
H06O01.3 Source_evidenceePCR846WS150 Sequence/Annotation Release
Chunk_score Abs_score720
Max_abs_score720H06O01.3
Specificity_index0.835
Rel_score1
Map_statusBest_ePCRI70077007009283
Overlaps_transcript H06O01.3 Source_evidenceePCR846WS150 Sequence/Annotation Release
H06O01.2 Source_evidenceePCR142WS150 Sequence/Annotation Release
WB_DNA_textsjj_H06O01.31584acaaaatattgcagtccggccgtccattcgaacaaatgacattagtctttgatttggaaaatatcacatctgctcatttttcatgcaaacagtttgcttcatcatttacaactcttgtcagtcttttccaagatcattacccattgtttcttcggaagattcttattatcaggttagtaataattacgtctttgttataaatgaatacatttcagagcaccagaaatggctagaattgcgtacgcttctattacggcaattcttcaagatccgatcactcgcctcgtggaaatgccttccgaggtaagattttttatttttgaaaaaattccaacaaaaaattttgaagtgtatattttcattatgttttctaagattatctatgatttttgtccaaggacttatttggtttcctaatacaaatattacaactgaataagactagatcaattcttcgataaaatcgttagaacttttttaataaggaaaatcaaagatcgtattaaacgttgaattgaactttaatcaataaatatttttcagtctgattggaaatggtctcttgctcaaatcgtaaacctcgatgcatggccaatgtattggggaggtaatctcgtcgaaaacggtgacccaaaatgtccgtcacgtatcaaatacggaggtggcgctgtcgatgaaagctatttcgtggatccaaaaaaggcgatggctgactacgatcaattgactacagtttacgcaggagataaacatttaattcagatcaaagtgaaacgtccaagccggataaggtttgtaatgggtttttgtggtggatcaaatatttgcaaattttcaacatgtatcttaaaagcatattcttgaaaaattgccaaatttaaactttaaacaattaggttgttttaaaattcaatgctcaacatttttgaacgccttattaaaacgtatttaaatcagatcatgtattataattttttgcggtcatctgccaaaattatgactgtaataaataaataaatttcgagttttactagaatattcggtgataaattttgtaataaaatattttccagctggacctatatgactgatgaagatgacattgggtttgaaattcattatgataaaacaggatcatgtgataagttaactgaaatggaaactgtttatccatatattcgtctcgaatgtacaaatgttccaatcacaggacatctcgatgtgactgatgttggaaactgttcgtttcttcttttttttatattttcaacttttcaagcgttcagatgttctcgaattcgacaactactattcgtggttctctgccaagcaattgcgctacaatattgaaatcgaagatttgtaaattctaatgttaatcggaggataacgctgataataataatgtataattatttacaattttcaaaactaatgattatattaattttatataaagatcacgctttgtagctaataagactattaaacagatcattattaaaggaaacaaaaaaagatgaaatgtgataaacatttgaaataaaaacaaaaaaaagtaaacccgaccaaagaaaacaggaa