Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H20J04.d   

sjj_H20J04.d RNAi JA:H20J04.d
Simmer:H20J04.d
PCR_productsjj_H20J04.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene H20J04.5 Source_evidenceePCR474WS150 Sequence/Annotation Release
Chunk_score Abs_score432
Max_abs_score432H20J04.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII43265094328185
Overlaps_transcript H20J04.5.3 Source_evidenceePCR472WS150 Sequence/Annotation Release
H20J04.5.1 Source_evidenceePCR474WS150 Sequence/Annotation Release
H20J04.5.2 Source_evidenceePCR472WS150 Sequence/Annotation Release
WB_DNA_textsjj_H20J04.d1677aaagccggaaaatacaaaaatgtagaaaatcggtgagaaattcaaaaataaatcggctttcactagtttttttgcaaaatattttgaaaaatctttttttttcaattataaaaattttttttggtcagttttggcaaaaaaaaccaaaaaaaaactggctctctaccattaaaacaattattttcaaaaaatccacaacttccagatgtcggccgctcaaaccgccgccgccactccagccgagcaagaagagcaacgaaaagtcgtcgaaaagttcaaggctctacgtgatcaacaacaggatatcgccgccgaagtgactcgaatcgaagaggaacgacgtgaatttggacgtgttctcgaagtgatcaaggatcttgaaccggatcagaaatgcttccgtttgattagtgatacacttgtcgagtatactgtcaaggatgttattccggatttgcagaataatatcgctaatgtgaggatttgaaagtcgggaaaaatagaagaaaaggcggaggaaacagtcatgtgtcgatttacggagtttgtgtactcctcgtggagaagattttacagattccggctgaaatacctgattttcgaccttttttctatatttaacgcgttttaaattggggatttacagtatttccgatgaaaattgacagttttttgaagcaaaaaaaaatattttttcatctgaaacactgaattttccgatttgttgcaccaaaaatacggtatctggaagctatgcgccttcaaggagtactgtaatttgaaatttgtggaatttatattgattttccgtagtttttcgataaaacacttcaattttaacaaatcgaatgaaaaaatataaacaaatcgatggaaactttgcaaattcgggtactctttaaaggtgcgcagcgtcatgtattcgaaacaaatgtcgtgtcgagatcagacatcgtagttttagcgcaaaatttcgcgtttttacacctaaaaattgaaaaaaaaaaccagattttccgttttttttatagcgaaacccccaatttgcgctgggaaatactgtaaaaatacgattttaatatggttaaatacaaaaaattgaaaaaaaaaacagacttctcctcgtggagtacacgagctgcgtaaatcgacacaagaccatgatttcacagccattttgccatttttaatgcgaaaattcattgaaaatcagtgtcaaaacatggaaaattaacggtttaatcttaaaataacagtaatttcaacgaaaatatttgagaaaacggtcaaaaatggtctgaaagttgaattttgttcaactttcaggcaatttttgagctctatcttggatatttcgattgaaaatagtgtaatttaaagagaaatcgagtgattttctatattttgtcacaaattttcagcagaaaaacatggtgcaactgaccagaattaccgaaaataataaaattttgcagttgacaatcgtctcgaagcagctcaacgatcagctcgtcgaaaagggaaaagagctgaacactcacaaaactacacacaacattcgtctgctcactgagaaagaatctgccgagctgagaaaagctgaagctcttggacaattgccaaaagcttaaatttcccctgctttaatttttttctcgatttcctactgctttttca