Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H26D21.2   

sjj_H26D21.2RNAiJA:H26D21.2
PCR_productsjj_H26D21.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH26D21.2 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Overlaps_Gene H26D21.2 Source_evidenceePCR1097WS150 Sequence/Annotation Release
Chunk_score Abs_score1034
Max_abs_score1034H26D21.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI36957683696958
Overlaps_transcriptH26D21.2 Source_evidenceePCR1097WS150 Sequence/Annotation Release
WB_DNA_textsjj_H26D21.21191ccctttgttgtttcgagaatatgaacatcttttttgcggatcgacttttcttcctgaaacgagagcaaaatgaagaattaacttctcttaaaattagttaccttcaaagtgactcggaaataaaatccatactgagaattcttatccaacttcaaattgtcgcattcgaatttcgcggaatatttcttgcgcaacttctccgcgactctctccatttgctccagcttctcactaatctcctggatctctggaacaaaatcgacgcgaacacgaatctctttgttctccttctcatagtcgaaatcgaagaactcatcacagagcacttggaatcgttcgactttcttcagaatttcggtgatttctgatttaagaagacgattaatcgatggggcaaactgttcagcttctgaaagttgaatcaattgcatttcgacagtctcgagaagagttgcagcttggtagaatcgattgagatcctgaagagtgcattttctcatgagacgacgagctagttgagagcaatctggcattcttgcaagaatggaatcgcggagcttctgacggattgtctgattctcgaacaaagcttcaacaatatccagtcgctcgttgatgtgatcgatctggcaaagtggacgagaaagccaatcacggagcaacttctctccaggaagagtcttgcatttgtttaaaacattgtagagcgtcaaattattcgatttctctgaaattaaattattttcaaggaaaatgtaacattataactctacccaaataattataattcaattggaaaagctccagagcctccacagcacatgaatcaatcagcatatttccatgagttccgtaattgaaaatactatacttctcagaaatactgtattcatcggctgcgttcgagtgtagaatttgaaggcattccttgatgttttcgttttgtttttcggcttcatctttataatccagatgaaccgactcgattacatcgctccattgtgactttggcttcagctgttgcttgttgtgaacctccattctcgtgaacatgcttgctattttcttagccttcggtgcaactgatccttcattcactagaatatattctgtggggcatagtccaaaaatgcattgttccgtttgagaaaaagaaggagtatcgatgtattcactgatcacaatgcgaac