Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H27A22.1   

sjj_H27A22.1 RNAi (5)
PCR_productsjj_H27A22.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Overlaps_Gene H27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1060679810607790
Overlaps_transcriptH27A22.1 Source_evidenceePCR790WS150 Sequence/Annotation Release
WB_DNA_textsjj_H27A22.1993ctttccttgctgccagaatcatcaacactccgattatgtcgggatttcacgaatacaactcgattcaaagagattctggctccaattatggttcctcgcattgttgacactaaacaacaccgacaagttggagatgtaagctcaaaaatattataaattatacgttgtttctgaaataggtattttcagtatttacaaagttttttgcataacttgggattcgctactgaatgggatgctttcactgacacaactccattagggactcgcaacttccgaaatttaattgcaacatttgatgaatcagctccacgtcgtcttgttcttgcatgtcactacgattcgaaaatcattcccggtcaagtaatgattgcggcaacagattcagctgtaccctgtgctatgatgcttgatattgctcaaacacttgctccatatatgtacaaacgagttgctcagcagattggacttcaattgattttctttgatggtgaagaagcattccgtgattggactgctactgattcactttatggatcaaggtttcttaattatagttattattatgaggtcgtagggagaacattttcaggcacttggcacagaaatgggagcaaaagtggtatccatcttcaagtagtctcaacaattttgaactcagcaaagaacttgataggattgtgagtatttatcttacgttttagtttagaacttttttttttcaggacgttctcatgctattggatctactcggagctgccaatccatcaattggaaatacgataggaatgggtgcaaacgatcttttcagccagttagctgatgtggaatcgaatctccgaacttcgggatgtcttagttctttgagaaggaatgtctttaataagcaattatcgtacaatcaagttgaagatgatcacattccatttttgaaaagaggtaattagcaagttgaatgacttattttttacattgcctatgtggtttccacaa