Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H28O16.2   

sjj_H28O16.2RNAiJA:H28O16.2
PCR_productsjj_H28O16.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH28O16.2 Source_evidenceePCR677WS150 Sequence/Annotation Release
Overlaps_Gene H28O16.2 Source_evidenceePCR690WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627H28O16.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1265043312652082
Overlaps_transcriptH28O16.2 Source_evidenceePCR690WS150 Sequence/Annotation Release
WB_DNA_textsjj_H28O16.21650aatcgatttatgaccgacacaagtctgctttttattggaaattagggggttttttctatgaaaatcaattcttttcacctactgaaagcctaatttaaagaaaattgcgtgaaaaaatcaataatcgactaaaaatatgaagaaaaacgaacttttcaactagaagttcacattttcacggaaaattagcgtttttctttgggaaagtgccaaaaaaaagagaattacagttaaaattgatttttaatagaaaatttagtttttctgtgtgatttcagttgaaaaatcggctcattttgcaatattttggatattttaatcctagatcttcgaatttttggcataattagaagaaaaaacgagaaaaaatcaatttttggctgaaaaaattcagtttttaactaaaaattaacgttttttctttgaaaatctgatatttttgtcgaaagaggccctaaaaaattaataattgtctaaaaaatatgaagaaaattgaatttttggattaaaaatcagtttttttttctgaaaatctctcttttttttacctagaaagaccttaatttagcttaaattgcgtgaaaaacttcaatatttcggtggaaattagaagaaaatcaaaatttgcaactagaaattcaaattttcacagattttttagctttttgggtgcttccaagctgaacaatcagctccgcaaggcaaattttggcggaaaatttcgattttccataccgatttccgtctaaaatcttcttaaaatggagaatcgtcaaaactgtgtgattttccacgtcttgtcgctcttttctggcgtttttcagctgattttccgccaattccataagagtgcgctcctcattcctggtaaatggcgtcctcgcctcgatttgagctttcaaacgatgtggcatggcgtcaagtcgaacttttgcggattttgatatttcttcgtcgaacattagctgacaataacgctcttctacgtcggaaaatgtgaattttcgcgaaaatgtcagcgaattgtggatgaaacggatgcattgaacgtgagcgacggcggtgagaagcgccagatcgtcggcgacggtccagatcctcattgggttcgtttccgtgattgagggctccatgtgaatgagaatctgtaaaaaatcgggggtttttcgaggaaaattcgatatttttgaggataatcctggattttcagcatcttccccgcaattctaacctttctccgcttcagttccggctcttcagacggctttttcatcaccatttgggcctccactgattcttcagtttcttccgcctgaaaaaatcaaatctaattttttatggaaatttatcaggtttcctgagatttctcacatgtatctccgagttttcttcaattttttgcttcttaaatcctgacagctcgttgggacgctctatatctctgaaaaatgtaatttaattcattttttagagcaaaattcaattattttaattaaaatgtcgaaacactcactcaaattgttcgatttttcgtttccttgtcccttcttcttctgtgtcttctattgtatccttttttcgctggccggaggcgaccttgtcgatgatttcgtcgagtttatcggccatttttgggacaaacctgaagtt