Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H31G24.d   

sjj_H31G24.dRNAiJA:H31G24.d
PCR_productsjj_H31G24.d
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH31G24.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
Overlaps_Gene H31G24.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
Chunk_score Abs_score288
Max_abs_score288H31G24.1
Specificity_index0.811
Rel_score1
Map_statusUnique_ePCRI41232874124974
K03D7.8 Chunk_score Abs_score67
Specificity_index0.189
Rel_score0.233
Overlaps_transcriptH31G24.1 Source_evidenceePCR330WS150 Sequence/Annotation Release
WB_DNA_textsjj_H31G24.d1688tctcgtattcacgcctcattattatcagaaccatttcgtcggccaacacacaaaaaaaagtcgaccgagacaagtacattctgtggtttatcgggtctccgtctctcttcataattcaattcatccggttaaatctgtggatataaaagaaatgccatcggcttttggccagttatctcaatcacaaccatcatcatgtatttgacacaatgtactctatttgtactgctttctgtcggatggtcatatgcatgtctttccggattgacgggtggtggagggggtggtggatgttgcccaccaggaccatcttgtcagcaagcaaatcactggtaagtctattgttgaaaatctttttaacgcctcactgttaggagaaaatatttaaaacaactcatgtaattctaaactagccaattagtatagcaaaactattcaatagttttctgaagttcagtgttcatctatcataatgtttagcagagttttatagtttaattttcggcatttcaaaattctgaaagttcaaacttgaaagcttctcaaactgtacaaattctcaaaaaatttcgaaacttgccaaaactttaactggaaatattgataaatccaaaatgaatttgtgaggatgttcaaattagggctgtgcaaccggacgtccggttttcggacgcgggtgcgtccggttttttttgttttttgtttacatctcagtgagaatgagtgaggttgtaaacaaaaaacaaattttcggacgtccgaaaaaccggacgccggacgcacacgcatccggacgccggacgtccgaattcgtccgattgcacagcccaagttcaaatacattgttaagcattttggtaatttccagcaatttaaattcttttgcatgttcgaaaccctgtagtgttcaaatgcatataattgacctataactaaaatttacttgtcagaaaccatattttgaattccaaaattaggataggtgaagaatgattgtcactttttgggcgtaaacttttgattttgggcgttttgattttgaaaacttgtactaaactttactatttgacattttagcatcataatccgtctttcagcgtgtagcctaggtttcctttatcgcggccacgacagttatctgtgttgcttctctgaaatatagaaaactagctcttcaaatttttattaaacttaaccacataatagcctatgaaattaattttcagtgcatccagctacgtgtctatacaagcttctggaccagttagctatgcgatcccacctccatcctacgctcagcctcctcagccatatgctcagtcaccgattgctgcagttcctccacctccacctccaccgccaccgcagccagcgccagcgcaagcgccagcaccaaaatatccaagtccgggaaaataattataaacgtttcttaaattatttctaatttatgttttaaaaatgaagccagtatttgttaagtttcaatacattaaaaaatacaaaatcccaaatatatcaacatgatcaaaattgcagattcgaggtcgtcgtcgctttacagtattccacgtagagacatgcatttatattggcaatccaatcttgtgtccgtttttacgatgcgagacgattcctcccttttacctccaatttcgttttgattagtcaacggatgggagagtaaa