Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H37A05.1   

sjj_H37A05.1RNAiJA:H37A05.1
PCR_productsjj_H37A05.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH37A05.1 Source_evidenceePCR1095WS150 Sequence/Annotation Release
Overlaps_Gene H37A05.1 Source_evidenceePCR1095WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1365533313656528
Overlaps_transcriptH37A05.1 Source_evidenceePCR1095WS150 Sequence/Annotation Release
WB_DNA_textsjj_H37A05.11196tttctccttttccttctgctcttcatcggcagtcgatgtcgatgatctccagaaccagctactccatcgtgatgtcgacttttcagcatcctcgtcttgtttttttcttttattttgttctcttgtctccggaagttctccccatttccagtcagtaacatcgtgtggttctggtgtggcattgcgatcccgttgacgatcaacttccgaatcggaaagagcaccatcggcaattcgatcagcctctctttgatcaaccaacgatggggatggtgatgaatttacagaagaatctaactccgaatccgaatcattatattgttgaattttaatgtcaattggacgagttgcttgttgattaaatgtgacacgactcttctttcgaagtggaatccgacgatccatatcgtgtgtttcccgtcttaaactacgtagaatctcatcatttgacttgtgaaaatgtttcttttccattggagagcactgtgaatgagagtggacaaatggccgtggagtcttccgtgtcctctttccgtcactcttcttgatatctgttctctccacctcggtctcagcagcgagaactgtaagatctgggagtgatcggtagcgacgatcactgaaaacagatgacgagaatggaagtgtctgctttctttgaacttgactcagtgattgcctgaaatttaattaatataataatcaaaacttctatttaatatcaactcactcttgtttcggctctctcgcatttccttgtcctccgtctggacttgacgatctgcttttcgcaatatcattcatatcgacatcttcattttcattctgcgtttcttccaactttcgtgcactctctgccaacactttgtccaccgcaggtcctgcagtctgtggggtctcttgctcgggcagtggagaagtcagaaggtagtctggtacttgatcgtcggcctcttcaacaaaaaacgcgacaccactgtcagccaacttcattttcaaatcgatttctacaccattgacagcgatatccacatatttatcactgtaactgaagactccatactttccaaaacgaacatggaatggtgttgatttgtattctccatttggttgctctacgacaaccacatcgattgctcctgaaagaatttaaattataaaaaagtaactagtgacacggaatacaaacctgaaag