Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_H39E23.1   

sjj_H39E23.1 RNAi JA:H39E23.1
Simmer:H39E23.1
PCR_productsjj_H39E23.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H39E23.1a Source_evidenceePCR869WS150 Sequence/Annotation Release
H39E23.1b Source_evidenceePCR869WS150 Sequence/Annotation Release
Overlaps_Gene H39E23.1 Source_evidenceePCR869WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848H39E23.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1412261514123618
Overlaps_transcript H39E23.1a Source_evidenceePCR869WS150 Sequence/Annotation Release
H39E23.1b Source_evidenceePCR869WS150 Sequence/Annotation Release
WB_DNA_textsjj_H39E23.11004tgacaaggtgctccaaaacaagtttaaaaactcacttggactctttgggtgtctcactggatgctttctgctgctgttgttccttgtctgatgatgaagttgcatcttctgttggtacttgaacagctggagaggtttgtggtccgacacctccgatcaatggaacatttccattctgattctcactgttattctcgtcgtcgtcttctcgaatgactggttcagtcggtgcgtgcgagatttgtgatccagatttctgaagtggcgctgtcgacgtggcagacgatgaggaagaagatgacgtggctgcagtaccaccagccgctggagtcttattgatgagctttgacatcattgtcgacgaggtgagttgattcatatactgctgctgctgagcatgatcccgatgacttggaataccaccattattggctgcaactgcacctgttgcagttcgatgtccttgtacagcagtcgaattgagcggaattcgtccttttggatcagcaatctttcgagtaccggtgattcctgttgaaggttgagcagctgatgaggttgccgttgagtttctattgaatagtggcggaatttgagcaatttgcgtggtgttggaggctgaaaatatgggaatttaattcgtgtcctttttctttttgtgaccaatttagaaatcattttcacccaattctccacaaaaaactcacaaggcttataactcggcggttgcaataaactgattgtcgcttgccgactcgtcggctgagctctcatctgaactccaccatgccttgttccactcatcactacagtaccaccagccgccgtcgctgccgcatcgttttgcgagcttctcctcgacgacgaagatcctgacgatggagctgccgatgattgctgatgtttctgagcattcgcagccgatgcgagcgctgatcctgcagtgattgatgcacctgtggctgttgctgaggatcgagagtatcgggatggctgaaaattag