Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02A11.3   

sjj_K02A11.3RNAiJA:K02A11.3
PCR_productsjj_K02A11.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02A11.3 Source_evidenceePCR849WS150 Sequence/Annotation Release
Overlaps_Gene K02A11.3 Source_evidenceePCR849WS150 Sequence/Annotation Release
Chunk_score Abs_score744
Max_abs_score744K02A11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI97463629747936
Overlaps_transcriptK02A11.3 Source_evidenceePCR849WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02A11.31575atttgagacgcctcatttggcacaactacatatattgggcatccgtaattttgatttttacttcacaaaccttattctgttgcataatttcaaaacttgtgatttgaagtggacatccgtcgaattcaacctgcaaatcttaaatttattagaaaaactccaaaagtcacaactaacatcacaagtctctcttcctcttcttgacaaaaaacacattgtatacagagccatatcaaattctggagatgttccaattagaattgagccagctcgtttcaagaggccgtcccatgtgaattttagtgcagccattatgttctgaaaatcaattaaaaaagtttccagttttctcacaatgaaaaaacttacgaatctttttacagtgaatcctttataatcaaaattctcggttcgattattctctaacacgtagaatctaacccaattatgcattccagagatttcaccattttttgcctaaatattcacactataaattgaattcaaatcttgactaacttctccaataaaaacatgttcaaaccctgaagtatccgggcgtcccaaagctcttgagtagtgtgaaaaccaaagttgtccaatccagaaccgaaatacttgggggcttgtggcgattggatgacctgaaattacaataaacaagtttttcaatggtaccaatggtaccagtacgtattggcccgatcaaccaggatttatgtattacataaatttaagaaatttaatattttcaatcaacagaaataaatttctcacctttagctttaaaccaattatatagttcctgcattggacgtgactctaacacatagtccaaaaactttccaacttcatttttctcttcagcttggctaacacgtggctcaataacaccggtttgtcgattgaaattgtccattaaattaatataaagctcatatgatggcttacgaaacagcgaagtatcaacctttgaaaaaagtttcgcttgtgctgcatcactatcatctcgggttactgtatgtccttgatagttgagcttaatttgatcgggacgagcacggtttgtgtctacttgacgaagtttttgagccattgcgagaagttccgagttggatacatcaaatcctataaactaattttgaaaaaaaaactacattgaacatttccaaacaatttcattcaaatagaaatttatgttaaaaaattgaattcaaatatttaatacatacaaaatagctcatttcaataaaaaaaaatctaatttttgaaacaaaaagataaaaaaaataaaacaattaatgtttcattcgagagtaaatttgatttttgtagaaaatttcagaaagtatggatttcaaaacccgacggaaagttctcacttgtcataatgtcagtcagtttttgaattcattcttaaaatttttaacagagatgatacttattttcaattcaatctaattttaaaaaaaaactcactcgggattttctggcactgtgccaacactgtcaagattgagataaaaatgagcacagagcacattttgtcactggaaaaagtggagtgaccgatgg