Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02B12.7   

sjj_K02B12.7RNAiJA:K02B12.7
PCR_productsjj_K02B12.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02B12.7 Source_evidenceePCR847WS150 Sequence/Annotation Release
Overlaps_Gene K02B12.7 Source_evidenceePCR847WS150 Sequence/Annotation Release
Chunk_score Abs_score700
Max_abs_score700K02B12.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI85270148528712
Overlaps_transcriptK02B12.7 Source_evidenceePCR847WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02B12.71699atgcatcatcatcccatccttttgctttttcttctttcttttttggaggtgcggcggctactggagccaaacgtggagctgttgtctttggtttgttgaatgaagactcgaattgagtaattgttgaagaagaatcatcatcctctacattttctgcggttactgaaaatttcgacaatcaacaatattattaaaattcctttttgaaatgaactatacctttttctttgctttgcactggcttgacacttctctcctttttcttttttgtctctaccggttccgttggtttcaattctgaaaatcaaaagtaaaaataggaaaaaatctacttgattcaaaataccttcattgctcaaatgatctccaccttcagttgttccacgtggcaaattagattgttttagccagtcgttgaactcattttgcgacgatgagccggacattccacctccgccaccaccaaagtcttcgtaaccactgtaagatttaaaaaataatgattatggcggaaatattttttaaaattacgttttagcgagaataccagagaaggcattgagagaaggtgattttacgaatgaagataatccatcccaggatttagttccaacttctgatgctttgttcgcgacaccaccaaatagtgaattgttttgagactgaaatttactttttttaaaattaatttctgactttttgataaaatcctaccacattctcgcttaactgtgacgctttctgctgagcttgaattccaacgtcttttgccatcgctgcagcttgagaagctccttttgaaagcatagaccagccctgtagaacaactattttaaaattgttaatctaggttaaatctaccattgaaagaccagacattgctccagcaagcaaatcatctccactatttgactgattcggtacatatccagtatttccgaatccttgatatttgctgtttctgaaaaaaaaacaattctgtggaactgtaagaaaacttaatttttgaagtctgtaatttctgaaaactgaaaacgtgaggttaaaaatttatttccatgtttggagagatactttcatacaattaaagaagcaaccgtttctcaaattagcgaacgggactttaaaaattccaattatcacccttcattgcatgatatcttttttttcaaacgttgcggccgctgcgacacagacaggctgacaaaacttgagtttttagttgaatctttttttcaacttgaaaatatgtatttattaaaaaaatttaaccaaaatatttttttaattttcaggacgtctttctacgaaacgtcgttttcgaactttttaagtctgatagaaaagtgtcccatatttcgttgcttcatctttaattataggaaagtatattttcagacatgaaaataaattttcaaatctctgaaaatatgtttatttcaaagctttcatccgacattacattttttcaggaattttcaaaatttttaatcacaaaattcagtcgttttagggaattttgaaatattcttccacctttaattgtttcaaaaacttacgaatcttgggtagaatatgccccatcgcctgtggattgtgaataacttgaatttccaccataataagaaccaagagacgagttccctgaagacttattagttggtttggattgagaagacattcctccaagtgttggtgg