Oligo: sjj_K02E7.2_f
| sjj_K02E7.2_f | Sequence | GGTTAGTGGAAGGAGCCACA |
|---|---|---|
| In_sequence | W03G1 | |
| C17B7 | ||
| K02E7 | ||
| R09E12 | ||
| PCR_product (7) |
![Adult](JavaScript:void
window.open("/cgi-bin/rnaidb/popUpImage.cgi?imgName=N2wormfinal.png",
"RNAiDB Help","toolbar=no, location=no, directories=no,
status=no, menubar=no, scrollbars=yes, resizable=no,
copyhistory=no, width=1000, height=550"))
 |
Please provide feedback if you are experiencing any difficulties with this website. |
| sjj_K02E7.2_f | Sequence | GGTTAGTGGAAGGAGCCACA |
|---|---|---|
| In_sequence | W03G1 | |
| C17B7 | ||
| K02E7 | ||
| R09E12 | ||
| PCR_product (7) |
|
Please provide feedback if you are experiencing any difficulties with this website. |