Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02F2.1   

sjj_K02F2.1RNAiJA:K02F2.1
PCR_productsjj_K02F2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K02F2.1a Source_evidenceePCR861WS150 Sequence/Annotation Release
K02F2.1b Source_evidenceePCR861WS150 Sequence/Annotation Release
Overlaps_Gene K02F2.1 Source_evidenceePCR861WS150 Sequence/Annotation Release
Chunk_score Abs_score747
Max_abs_score747K02F2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68392206840402
Overlaps_transcript K02F2.1b Source_evidenceePCR861WS150 Sequence/Annotation Release
K02F2.1a Source_evidenceePCR861WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02F2.11183tccactcaatgaagcactcgcagcgattccgatagcagtgccggatgatcaatcatcaacagaaccaatggatatttctgaaggttcaatcacatcaggaaccaaaggatgctctaacgaagctccacagtcttcaactgttccacctgtgacaagaattcccataaagaagccaactacttcaactgagaaaccagcaacagcacctcctactaataactttgtctcttctgcaaaagtttgtccagctgacagttctctcctggcatatgttctaaacaagcaggttatactgctcatggatatatattcgttaaatattaatgtttttcaggtatacattgagaaaaacggtaaaattatccataggacatcatcaaattcaaagcacatcacaaatggcgtaccgtcttacattgttcaggaagaattggaaagattcgaaggaatttggtggagtgaatctaagactaggtaaataattagcgagagacgaaagaaaaattttctatatttaatttgttccttcttcgaagatatcctttcaaaaaatttttcgaacaataaattctctagtttcagactcctatacgaacacgtaaatgaggaaaaagtcgctgaatctcaatttggtgtcaacggagatccgcctgtggcaccaatgaagtacccgagagctgggacaaagaatgcctacagtacactccgaatggttattttggaaaatggaaaggcttatgatgttccactcaaggatgaggttatctataaacattgtccattttatgaatacataacacgtgcgggattcttttccgatggaactacgtaagtatttgagctttgttagaacatatttttcatgtataaattctttgttaatcgagaatttccagagtttgggttcaagtgatgtctcgtgatcaagctcaatgctctcttcttcttattccttacacagatttcttgttaccagaagaacttggggggtcaataaaagaagatagtaagtttgaaatgccttgaattcctcactaaacccaattttaaatcaccaagatttacaactgagcactgatttgaatatgggcgtttgggacgacaagtcgcacgaagaaacaatggaaaagtaatttaagaatgatctccgactcttaaattgtaaaaattacagaccgccacg