Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02F2.2   

sjj_K02F2.2 RNAi (3)
PCR_productsjj_K02F2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K02F2.2 Source_evidenceePCR1117WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRI68367596837958
Overlaps_transcript K02F2.2.2 Source_evidenceePCR1092WS150 Sequence/Annotation Release
K02F2.2.1 Source_evidenceePCR1117WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02F2.21200cgaaactttttccaggtccaatggtcttcctgcaacatcttctccacccaagatcacgctgctgccgccattgcccagaccggagtcccagtctacgcctggaagggagagaccgacgaggaatacgaatggtgcattgagcaaactatcgtcttcaaggatggacaaccactcaacatgatccttgatgatggaggtgatcttaccaacttggttcacgccaagtacccacaatacctcgctggaatccgcggactttccgaggagaccaccactggagtccacaacttggctaagatgctcgccaagggagaccttaaggttccagctatcaacgtcaacgactctgtcaccaagtccaagttcgacaacttgtacggaatccgcgagtctctcccagacggaatcaagcgcgccactgatgttatgctcgccggaaaggtagccgttgtcgctggatacggagatgtcggaaagggatctgctgcttccctcaaggctttcggttcccgtgtcattgtcaccgagatcgatccaatcaatgctcttcaagccgctatggaaggatacgaagtgaccaccctcgaggaggctgcaccaaaggctaacatcattgtcaccaccactggatgcaaggacatcgttaccggaaagcacttcgagcttcttccaaatgacgctatcgtctgcaacgttggtcacttcgattgcgagattgacgtcaaatggctcaacaccaatgccaccaagaaggacaccatcaagccacaggtaagaaaatgttcagaattaggatgaattcacaatcatcgatagaagtttgaaccaacttttttcaggttgaccgttacaccctcaagaacggacgtcacgtcatcctccttgccgaaggacgtcttgtcaaccttggatgtgccaccggacatccatctttcgtcatgtccaactccttcaccaaccaagttctcgctcaagttgagctctggaccaagttcggaactccacaagaatacaagctcggactctacgttcttccaaaaacccttgacgaggaggtcgcttatcttcacttggctcaattgggagttaagcttactaagctttccgacgagcaagcttcataccttggagttccagttgccggaccatacaagccagaccactacagatattaattttgttggttctaccccatacgga