Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02F2.2   

sjj_K02F2.2 RNAi (3)
PCR_productsjj_K02F2.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K02F2.2 Source_evidenceePCR1117WS150 Sequence/Annotation Release
Chunk_score Abs_score1075
Max_abs_score1075K02F2.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68367596837958
Overlaps_transcript (2)
WB_DNA_textsjj_K02F2.21200cgaaactttttccaggtccaatggtcttcctgcaacatcttctccacccaagatcacgctgctgccgccattgcccagaccggagtcccagtctacgcctggaagggagagaccgacgaggaatacgaatggtgcattgagcaaactatcgtcttcaaggatggacaaccactcaacatgatccttgatgatggaggtgatcttaccaacttggttcacgccaagtacccacaatacctcgctggaatccgcggactttccgaggagaccaccactggagtccacaacttggctaagatgctcgccaagggagaccttaaggttccagctatcaacgtcaacgactctgtcaccaagtccaagttcgacaacttgtacggaatccgcgagtctctcccagacggaatcaagcgcgccactgatgttatgctcgccggaaaggtagccgttgtcgctggatacggagatgtcggaaagggatctgctgcttccctcaaggctttcggttcccgtgtcattgtcaccgagatcgatccaatcaatgctcttcaagccgctatggaaggatacgaagtgaccaccctcgaggaggctgcaccaaaggctaacatcattgtcaccaccactggatgcaaggacatcgttaccggaaagcacttcgagcttcttccaaatgacgctatcgtctgcaacgttggtcacttcgattgcgagattgacgtcaaatggctcaacaccaatgccaccaagaaggacaccatcaagccacaggtaagaaaatgttcagaattaggatgaattcacaatcatcgatagaagtttgaaccaacttttttcaggttgaccgttacaccctcaagaacggacgtcacgtcatcctccttgccgaaggacgtcttgtcaaccttggatgtgccaccggacatccatctttcgtcatgtccaactccttcaccaaccaagttctcgctcaagttgagctctggaccaagttcggaactccacaagaatacaagctcggactctacgttcttccaaaaacccttgacgaggaggtcgcttatcttcacttggctcaattgggagttaagcttactaagctttccgacgagcaagcttcataccttggagttccagttgccggaccatacaagccagaccactacagatattaattttgttggttctaccccatacgga