Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02F2.3   

sjj_K02F2.3 RNAi JA:K02F2.3
Simmer:K02F2.3:Screen_A
Simmer:K02F2.3:Screen_B
PCR_productsjj_K02F2.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02F2.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene K02F2.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
Chunk_score Abs_score727
Max_abs_score727K02F2.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI68168126817982
Overlaps_transcriptK02F2.3 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02F2.31171atggcagtttctgatttgcctggaaatccgaatgctgtgtggactgtgaagaagaatatcgaaggtttcatttagaataaaaattaaaaatctgaccaatttcttaaaatttaaaatttcagaccaatatgactcatatattgttgtttcctttgtcaatgccacacttgcactaacaattggagatactgtcgaagaagcatcagattcaggatttcttccaactacaccaactattggatgtgcaatgattggtgatgattctcttgttcaggtatattcgaaaagttttctgttttaattatcttttttttcagatctactcggaaggtattcgtcatattcgggcagataagcgtatcaatgaatggaaggcaccaccacggcgacaaattgtcaagtgtgctgttaatcgacgacaagttgcagttgcattgacaggaggagaacttgtgtatttcgaattagatttggtagaattttacagaaaataacttaattcaaattaatgatcattttttgcagaatggaacattgaacgagttcacggaacgaaaactattcaacgcagatattgcatgcatgacgttcagtgagatttcagaaggagaactcaattctcgttttttggcactcggaacagttgataacgctgttagaataatttctctcgatccaaatgatatgcttatgccattgagtactcaaagtcttccatgtccaccagaatctattcttcttattgatacaccgaatgaagatggaaaaggagttgcagctgttcatttgaatattggtttgcaggtttgtattctattactaatttatgagtttttgattcttgaataattaataaaggtctactaaacaaacaatattttcaaaatcgcaatcgactacgttttcagaatggatgcctcttccgtaatactgtcgataatgtcactggagctattatggataccagaacacgatatcttggtaccagacctgtaaaacttttcaaagtacaatgtcagggacgatctgcggtaaatttcattatttttaaagttcagaaaagtatttattttcattttttgtaaatttcagattctctgtacatcttcccgttcatggcttctctatcacttccaacgccgctttcatttgacaccactcagctatgcga