Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_K02F2.4_b   

sjj_K02F2.4_bSequenceGTTGTCGTGGCGTTTCACTA
PCR_productsjj_K02F2.4