Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_K02F2.4_f   

sjj_K02F2.4_fSequenceGGGACGAAATGAAGATCGAA
PCR_productsjj_K02F2.4