Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K02H11.2   

sjj_K02H11.2RNAiJA:K02H11.2
PCR_productsjj_K02H11.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02H11.2 Source_evidenceePCR1019WS150 Sequence/Annotation Release
Overlaps_Gene K02H11.2 Source_evidenceePCR1019WS150 Sequence/Annotation Release
Chunk_score Abs_score893
Max_abs_score893K02H11.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV15202211521752
Overlaps_transcriptK02H11.2 Source_evidenceePCR1019WS150 Sequence/Annotation Release
WB_DNA_textsjj_K02H11.21532ggcaaagaacccatgaaaaaacaaaaaattttgcggggttggaaagttgaacttaacaataaaattaaaaattaaattgattttacaattttaacagattgtgatgttgttgctataggagtttcttgttgaacggcgtagatcttcttccgtgtacaaggttctgaaataaaaaagtttaaaaaattttagtttgcagcattgtgatttttgttttagactgtgttttgtttttcaaagttgcttgagcggtgatgtctgaatgtttcactctagaaaaaactcactgaacaaagcattccgaaaattcttgataattattaaggttggcagtggatccaaaactggatacaacgccactgcaattccaagtactgctccagccatctcatttcctttgtgaaatattggtgaagtgaacgcaataaaagatgggagttgcatcagaaaaactggaattagtgcttgcaaaactaatgcattcaaaagttgaagttgcatcgagtgatattgttttgagttgctcgtgtttttggcaaaagaagccactgctcgatagctaagtgtcccgaaaattagcattgtggacgatgataaaatctgaaataatttgagaaatttgaaaaagtgcataagaacacgtggtgtcagagtgtcccatttcggttcgatctacgtagatctataaaaaaagcggggcagttctcaactgattttgtatggttaagaacgtgccgacgtcacattttttgagagaaaaattcccgtattttttgtagatcaaaccgtaatggggcagtctggcaccacgtgcaagaatacagtaccactgtaaatataggaactgcaattccaaaccaactcatcaaatttatagccacgttgcccttctcatcagtgaaccaataattttgccctatatagattaaattttccactttcaatgttcgatttgataggtacgtctttcttcaaattttgtttttaaaattagttccgaataattcctcaccttaaaaccatattagtcttttcattctcgctcagtgtaaattctatggctgttgcgtagaaaattccataaagaatcggggagaaaaaccacacaaaagattttccaaaagaatacgattttacatacgagctcctgaaatttgtaatctataaaaatattttgagaaagttgataggttaccccgaaactgccaaatatcggtaaataaaatgaagagcaaatatggccatggaaactgcgaaaaatgtgcaaaatactacatttatcaccttatatatccacctaggcagactactgttctcatagaaagtaatgacaagaaacatggaatcaaagcaatacaaatcaggtgctgatatgatatcaacaatagcgtatatcatctcaaaaagagcaatgtagatcattaagtatttgtagaagcccagagattttggagaatgacggagaatcaaatatatcagtagaatatttatcgcaagtgcgagaggtgcacataccttttgaaccagcgctt