Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K03A1.6   

sjj_K03A1.6RNAiSimmer:K03A1.6
PCR_productsjj_K03A1.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK03A1.6 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene (7)
Overlaps_transcriptK03A1.6 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textsjj_K03A1.61171tatcgtaggctttcgcaaaaatattgatcttcaaagaaaaaaacatgccgatttttaaaaaaggttacttattcatattcaaaaatgtttaagccttttctctgaaaatatgttttttaatttttcacgatgatttttggaaattttcacaaatttggacgagttcgctcaaatgtctcatatcttttccaacacttaaaatatgtcaaaattttcaactacgaaaatgtgtaaaaaaacaacattcaaaatgaacagtaaatgttcatactaaatcttatttgtatttagattaatatttaacaagttgggtcagaaggggccagggtggtcgtggcagcgccgttatccgagcctgtaactgaaattgagtcaaattcaaaattgtccttgactgtgacctggctgaacaatatgattttaaagagttttctctgttatgatgtattttttcaaaaacacggggttgcaatttagcaatgcatatatatactggcatcacagcatatagtttttggcggatctgggactgattcagaaaggcatttggtgacgtcactaatggaacctgtctggtctgtgctggtatggaagcagacactttccagtattgtttcaacaggataaaaagacaagacaaactcaaagaaaagtttttatattgaacttttgctgatttgcaacagtgaataagaaataaacattttatgatgcaaagaaaaataggattttagatatgtggccctaaagagggccgttgggttcggttggttgtatgaaatcgagagataaaattatcctccgaatccgtacagagttcttccttgacgcttcaaagcgtagacgacgtccatggcggtaacggtctttctcttggcgtgctcacagtaagttacggcatcacggatgacgttctcgaggaacaccttgagaactccacgagtttcctcatagatgagtccagaaatacgcttgactccaccacgacgagcaagacggcgaatagctggcttggtgattccttggatgttgtctcgaaggaccttgcgatggcgcttggcaccaccttttccgaggccttttcctccctttccacgtcctgacattgttgcagttgaataaagactcacaagtgagatgaagaaacggacagttggctgcctcttttata