Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K03E5.1   

sjj_K03E5.1RNAiJA:K03E5.1
PCR_productsjj_K03E5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK03E5.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
Overlaps_Gene K03E5.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
Chunk_score Abs_score656
Max_abs_score656K03E5.1
Specificity_index0.815
Rel_score1
Map_statusUnique_ePCRI34295593431835
Y67H2A.9 Chunk_score Abs_score149
Specificity_index0.185
Rel_score0.227
Overlaps_transcriptK03E5.1 Source_evidenceePCR836WS150 Sequence/Annotation Release
WB_DNA_textsjj_K03E5.12277cgcaaatcatttctcaatcctacagtaaccaatatgatttatcagtatgaaaaatgtatgcacctcattttacgcgcaattttttttgactaaaattgaaacgcgcaaacaaattttgggtgcgaaatccgtggcctaattttcttgcttttgtggccgagttttttttagcaaatgctcacaatgcaccatatttgacgcgcaaattttgtcgagcttattttcagatattatgaacggccaagaaaaaaagcccactttacgcgcaattttgaaattgcgccgaaattatggtgcattgtattttctagttttgcacacaatgcatcaaacttgacgcgcaaataaaattttcaatcctacagtaacccactcaacaaccggcagcccacctccacagttcgatcagtgtctgtcgatcaaaggaatcggattacaaaactttaatatattcacttcgcccaattttcctgataggtatgctttttgcaaaaaaagttgcaaaaaattgaaaaaaaatttgcaggtaccctccgaatattgactgtgtccgagtgatacattctcgtccgcaacacgatgttgtcgtcaaattccatcacgtttttcatgtaagttttttgggaaccttatcgattttttacgacactccgatgttccgctggccacgtggccgggtagaaactcggccgccaagccataagacgcaccgaagtgtgtaattgaaaaatttaattaagatttccagattgaatcaacatacgacaaaatagacgctggcgaggagtgcccgaatgattttattgtgggttctttttttggcttttagttcgtttaattgatgtatttggaagtgaaatcgaaccaaactacacagaaatcggaaaatctatttagctagattgaaaagaaaaatattttatttgcgcataaattattttgcaattatactataaaagttagagaatgatacggtacccggtctcaacacgacaattgattgttagccgcaaaaaggtcaaacttttgttggtgctgaatagatttttcatagctattctgttttattgtagtctttaatggaaaaaataatattctctgaaaaatctaggaaaatcctgaaataacgaaagtttgaaattacagtactctttaaaggcgtttatccttttgaatttaaaacaaattgtcgtgacgtgaccagctaccgtatcgttgacgcaaaaatcacaaaaattcgcaactttgcggtaaagaacctatttcgctacgtggccgcaaacaagaaaaactcggccaccagcaatgcatcaaatttgacgcgcaaattcaaacttttcttcaggaatttcgtgatggccgatacgggttctctccgctcatcgctcgtttctgtggcgaccgaatgccgaaacgagaaattcgagcagtttcgggtaattccaaacattttcaatgccttccccacaaatatctgaatttcaggtttcttatggatccgttttcggtcagactctatgctagaatatcaaggtttttctgcagaatatgcgattgttccaagtaaaactggacgatttaataatcatggtatggtggtttttaaaattttggaaacacaaaatactaggaatgcgtattacacagcatatttgacgcgcaaaatatctcgtggcgaaaactacagtaattctttaaatgaatactgtagcacttgtgccgattaacgggctcgatttatcaacagagtattaaaataagcaaaaaatgagaaaataataagggagcccgtaaatcgacacaagccctacagtagtcatttaaagaattactgtagttttcgctacgagatattttgcgcgttagaattttgcgttcccgtaatagtttgatgaatacaccagatttgacgtgcaagtttcaaaacaaactaatgcagccaattttcagaatgtcttctagaatatttaaatggattggatggatttatccgaacaaaagatctaatttcaaaccttccaagaaatgcatcgggaaccttggactgtgtatggcggttggcggttccgaataactttcgaattgcattttacgtaaaggaattcgcgttgactgctccgaatcaatgtgctcataattttgtagaagtttactcgggagacacttcaaataaaccattgagacggttagttttgcgcgtaaaatatggtgtctttgtgtccgcgtaatacaccatatttgacgcgcaacttgaaaacattgcagattctgtggtct