Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K03H6.1   

sjj_K03H6.1RNAiJA:K03H6.1
PCR_productsjj_K03H6.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK03H6.1 Source_evidenceePCR848WS150 Sequence/Annotation Release
Overlaps_Gene K03H6.1 Source_evidenceePCR848WS150 Sequence/Annotation Release
Chunk_score Abs_score743
Max_abs_score743K03H6.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV15245791526187
Overlaps_transcriptK03H6.1 Source_evidenceePCR848WS150 Sequence/Annotation Release
WB_DNA_textsjj_K03H6.11609gtccgaaaagtagcccatgatgtgtcggctgctatatctccctttttaggtagagttttagcggccaacatctatgagtggatttatacaatgcaagaaaaactaacccgcaagatgtcggtcgctattactgtgtctataggaaagattttatctcagcgcccgacacctcatgggtcggtcgctgaaaattctgattcttcaggtatttctacctgaacaccaaacaacacatgtcagcagtggcgaactggatgagtgccgctgcgatttggtaagctctccctttcctctattacaagtgcaccaccaacaatatttcaggctaatcctagcagtatccatcgaacgctacctgatcgtccgatcgccgttccgcgccaaactctattggcaacgtggaaaaatggtggtggtcctgtcgtcgatcttcgtgacaaccgggttgctcacagtataccaccattttgaatgggactgtgtgatcgaggagttctgtaacggtacacagcttctcgacttttgctactactctgggatgcggcaccagaaaacgtatcggaacaaagactgggtgacgccaagcaatgtgaagaaggtctacctgaagttttccacgtttttgaacgcgattttggtagggtattctagatatatttttcgaagaaaaatggaactttccaggttgtattcgtcccaatagttttggtcatagttctgaatatgcttatgattcggcagttgaagataaactggacatcaccaagattggagtcgatgagaggagccatgactaggagccacgtggttagtggcaagcaaaagcctgagcttaatcttaaatctaggcctagacctgaggctacgcctaagcctaaacattagccgaagtctaaacctaagcctaaacctaagcctaatcctaagcctacacgtcgtgtcaaaacctcccattttggtttgatcttcgaaaaatgcgaagaagagacgcagacttttcaaaaagtcacattttcttggtggggggaaaattgccgcattttttgtagatcaaaccgcaatgagacagccttacaccacgtgagcctaagcctagcttatgcctaagtttgagacttagcctaagcctaaacctaagcctaagccttaatcaaaatcgaagccaaagccatattgtaagcctaaacccacttcacactttacatatctaattttcagcgtcaacgtcaacgagtagccgttacagtcatcgccatcgggctctgtttttctctaacccaaggaccatctgcattcatggctctttacgaacttttttccgaatacgaactcgggcatactttctacgcgatttttaggtacttcaactaccatatacatccattgaacatttattatgtttttagcataacgaattcgctggtggtcactggtaaaacgatcaactttattttgttctgcctgtcatcggaacatttccggcagaaatgtttcaaggcgatctatcggaaatttccaaaggtgaggagaggttcatgtggaggagccgtgaaccatagtggtatgggggtgtacccggagaacgcgggaatccacggagccataagtg