Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04E7.2   

sjj_K04E7.2 RNAi (15)
PCR_productsjj_K04E7.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04E7.2 Source_evidenceePCR888WS150 Sequence/Annotation Release
Overlaps_Gene K04E7.2 Source_evidenceePCR1012WS150 Sequence/Annotation Release
Chunk_score Abs_score949
Max_abs_score949K04E7.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX64605996461752
Overlaps_transcriptK04E7.2 Source_evidenceePCR1012WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04E7.21154aagccaactgatggaactggagaattctctatggggtaggggtgttcataacacggaacaatggttaaataatatataaattccagaattgtcactgtattcaattcttcatacggaggaaactttgccatgtgccgtcaaaatacaagcgactttgatgttaaccatccatgtaatccaagacatcctgctgacttttacttctgggaaaccgattataatagtcataccgatgacagagatcaaaacgctacaattactggatctcttagttcccaaccggctgtaacttacaagcagaaatctgtaaagccaggatattggcagttgtactaccttttgaatacaccaaaagatgtagaccggcagacttacaacaaaacagcaacactcgttgctccaacaaattacggttttcacagagttaagcagggaggtgtgttcatctatgcattgaccggaacatacgaaaatccaaagatccacgagcttcaaattgtacagtccaatagtgtgtcgattctttggcagattccacaaatcgttgtcatcacggcagcagaaattttgttctcaattaccggatacgaatttgcatattctcaggtaatgttaatagttaaaatttataatttataatgctattctaactgtaaatattacagtctgccccatcaatgaaagctctggtacaagccctctggctcttgaccactgctgctggagattccatcattgtagtcatcacaatccttaacttatttgaaaatatggccgtcgaattctttgtctatgctgctgcgatgtttgtagttattgccatctttgctcttctctccattttctattatacttacaattattatacaactgatgaagaggacggtgaaattggagttgatgatgaggaagaaattgaggatcacaatccacgatattcaattgataacaaaggtttccatccggacgaaaaagatactttcgatatgcatttttaattaaatcctaatatgtataaattttcaattttgttttcctaaacctactactgttgctttcccttattgtgacatcgtgataaaattcgttttcacttgaaaaaataaatatttctaaaaactttgttcatgtccactctcacaacaacagccgaa