Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04F10.2   

sjj_K04F10.2RNAiJA:K04F10.2
PCR_productsjj_K04F10.2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04F10.2 Source_evidenceePCR707WS150 Sequence/Annotation Release
Overlaps_Gene K04F10.2 Source_evidenceePCR707WS150 Sequence/Annotation Release
Chunk_score Abs_score602
Max_abs_score602K04F10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI63627106363893
Overlaps_transcriptK04F10.2 Source_evidenceePCR707WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04F10.21184cacagtgaccacttccgatggaaattctgatctatctaaaaagtaagttctttgcattagtctcagatttttcttcatgattctttttttccagacttttcaacggtcgaaacctaactcgtgatcctcatgacatgtggcttgttgactttgattcaaagaattttacaacaatttcaataacttttcatgacaacgttgctctgaaagcaatttccgtctggaattataatgctagttttgaactttcatacgccggagttaaggcagctaagatttacataaatggaaaattgatcaagaatgttttattacgaaaagctactggattcgtatactttgattatgtgcaagatgtggttcttgacccaaataacactgaaagagattttgtgccaaagggaataagtcaaagtattggtggatgtaagtaaatctacttttgaaaaaaatttaaactgataaagttaaacaattttgataactgaagcgtttttttttcaaattttcatgttcttcaaaagtggactaataaattaggaacttgtttccagaacgtattactcataatcagtttgcaaatatcataattttggtagtccactaaataattttcttcaattttcaaaattcaattatattcaagttattattctagtatcgtagattatcaacatgcgaaattgctttgaacttctggaaaccatgaaactttgatttttcttgtcttactattagaatgaaaaaaatccaattttcagtcgtatttcaaattcgtcttttatctacatggggtgatgagttctacattggactcaatggaattgaactttataatcggaaaggagaactcatgaaaattagagaacatagtaaactttcaatttatgaaatattcaatatatcagttatgtttcagacttggcagcatttccagaaagtgtaaacattcttccaaatataaaaaatgatttgcgtacttcaaataacctaatcacacaacctaatgatactgacatgtttgttgtttcaacctattaccttataaatagggtatttcagagcaagaaatatgtggctgacagctcttcttccgaatagatgtgctcgagtcttttttgtgtttgatgttcagacatatatctcaaaaattgtaatctacaattatcgcaaaacccctgaac