Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.1   

sjj_K04G2.1 RNAi JA:K04G2.1
Simmer:K04G2.1:Screen_A
Simmer:K04G2.1:Screen_B
PCR_productsjj_K04G2.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K04G2.1 Source_evidenceePCR739WS150 Sequence/Annotation Release
Chunk_score Abs_score615
Max_abs_score615K04G2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80268278028026
Overlaps_transcript K04G2.1.1 Source_evidenceePCR739WS150 Sequence/Annotation Release
K04G2.1.2 Source_evidenceePCR739WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.11200gctttcctacgacagccttgaatccactcttgattgctgtaacagagcatctggaaccacagttagtacattggaggaagaagagacgagtatccttggtgagctgtgtttctggcgacttgcaagtatggcacattacgtactcctctgaaatacagaaaatatacaatttttgggaaatttctattttttactgatatatttccggaggacactttcaaattgtttctgttgccatcttcctttcacaatcaaacagttacttccgtcgatggatccagtcgttcccaattccgcgagcaaaaattggagcacgtgtttgtcttgtcttttcataagccggcaaatttcgaggaagttggagaaagcagtcttctttgatccagctcttgcaacttctgggagcttgatggcgaacttcttcttgtctccagcaaagtctggatttttgtctttcataacctgatagacaagagtgagagcttcttcgtatgtgtaatctggccatgccccttttgcatcgatcaagttttgagctccaattccgatttctgaattcataattatttattttgaaagagtattgtgcaaaattatagttttataactttgtaataaaatatattaccgagagttggaactttctcttcaactacttcttcgccggctgtctttggagttttcttcttctttttagctccaaggtttagctcgcctgtaattttgattaattaacaatcagatacacatcttcatcagctcacccaagccatcttctacagcttctacgccggtctcaacaggagcatcatcgccatcgattttgatcaccttcttagacttcttcttttttccgagatcgagaccctggagaaatataaattcaatttgaagacgagataaattaactttaccaaatcgtcagccatagtttgtttgttttgcttgaagtacaaaacctggaattgaaaaatcatttaaatgaagatgcgaaacgattttcatgaagaaaggtaggcattttgaatctcgtaatatacatacaatttaaaaatacattttattcactaagttttgaagattatttgccgtttcagttattttaaaagacaaaatgggttgcgaaatgcaaaaaatgagagaaaactttcaaggcgcatgaagaatggctgtggtgaggtctcgccacgatttctcttt