Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.10   

sjj_K04G2.10RNAiJA:K04G2.10
PCR_productsjj_K04G2.10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.10 Source_evidenceePCR746WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.10 Source_evidenceePCR746WS150 Sequence/Annotation Release
Chunk_score Abs_score725
Max_abs_score725K04G2.10
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80595078060355
Overlaps_transcriptK04G2.10 Source_evidenceePCR746WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.10849ggtgcgagaggaaccagataatatcgatctcatagcaagagagaaatgatgtcatcggagcagatgttctcctttcctatgccattctttttgctagttacagcactacattatcgattgcagctttgggtctcgacacgaaaacgctcgtctccgatatatcgactgctactgtgctcaatcaaacattacccatctttgttcttgttttccttattttttattttttttggaacacattaatttttatattttttatttatttcagaaactcaacactaaaaagaagtatgcaacgctataatccaccacaaagctcgaatcaaatgtactgcccaggatgtaatcgtcaaattcgaaaagttcaagagttgatggacgagaggtacctgacaaacatttgtaatgaagtggagaagaacaccatgagacttcaaattcaagatttggagagacaagttcaaatgcgtcgatgtgagaatcggaagatgaagactattcaggaagtcgaaaaggaaggatcaacagaatctcaagattcaattcatgaccatccaatggtaaaagtgttgatggagatcaacgatcaattgatgattgaaatgagaaaaaaggttgaagctccagaagaatatccattagaagaatggaaagatgctattgaacaaaaatggagtgaaaagtatgaaaagcttcgtgattatgcattggatcaacaagacatggtcaaatatatggaagagaatgatgatcgacaaaaagaaagtattgagaagtataaacggaaaattggttcgatgaaaaaagtaattgaaaagatggaattcgaaatggcacttcttcaatcgg