Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.4   

sjj_K04G2.4RNAiJA:K04G2.4
PCR_productsjj_K04G2.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.4 Source_evidenceePCR747WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.4 Source_evidenceePCR747WS150 Sequence/Annotation Release
Chunk_score Abs_score600
Max_abs_score600K04G2.4
Specificity_index0.842
Rel_score1
Map_statusBest_ePCRI80359078037087
K04G2.5 Source_evidenceePCR134WS150 Sequence/Annotation Release
Chunk_score Abs_score113
Specificity_index0.158
Rel_score0.188
Map_statusBottom50_percentile_ePCRI80359078037087
Overlaps_transcript K04G2.5.1 Source_evidenceePCR134WS150 Sequence/Annotation Release
K04G2.4 Source_evidenceePCR747WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.41181gccgacaaaataccaggaaatcgtatcgtgtgcaataagagagaaagattcaagaatgggctgtagtcatagtaaaaacaaaaactcaaagtccaaatcagcgatactgaagaaagagcatccattggaacgatcgattcatcacaatcgagttgcacatttcgacgaaacgtgagttaactttttaatatattcagattatcaattattctatgattcagtcagccaacaagtcaatcgacaagtgttgaatcagaagaactaaatgtgaagcattactcgaaaactttgctcaacgatactgtggagccaactcatcagaagactagtgcacacgttccagagaaaagtatcaagaagcaaggtaaacggcttttgttgaatgaacaaagcatcttatgaaagtttttttttatttcagaagtcaagcaagaagtcaaaaagcatgaaacaaccacagtcgttcacacgaatgtacatgtgccaaaacctactcataagctaccgtaatttttcataaatttgaaggcgtattggatgttatttggatgcaatattttgtgattttcgcgagaaaattatagtacagtaccgtagttttcgggcagaataaaaattttgcatctgaataatatcttatcgaaacatccgaactaacaaaataattatttgaatatttcagacaagcatctgaaattcctattgaaagaatgggatcagatcctcatacagctattgcacctacttaccaacaaaaacagttcgccacatctacttactacccaatgcccacaattggagaaaaacaaaaatcaccagaaaaagcaaaaccggcaagaaaagttgataatactgatgaaaagaagagaaagaaagatcagaatgaaaagccagttatcaatggtgagataataaattaataatagaaataagaattggaatccattcaggaccaaatgttcgtcatcaattgactccagaagatttggagtatatcaaacgatcggttcaacaaagaaacgaacggtatatattgcaaataatttatgacatgaaataatgaacacatttacagacgtgcgtttatgatggctcatcgaaatgaaacagacgacacgttgtatgagcttgaagtacgaatgccggaaaaggactacacaaatcgaatggaggttggacag