Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.6   

sjj_K04G2.6RNAiJA:K04G2.6
PCR_productsjj_K04G2.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K04G2.6 Source_evidenceePCR882WS150 Sequence/Annotation Release
Chunk_score Abs_score819
Max_abs_score819K04G2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80422378043314
Overlaps_transcript K04G2.6.2 Source_evidenceePCR730WS150 Sequence/Annotation Release
K04G2.6.1 Source_evidenceePCR882WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.61078tcgcactgagccaacattacttcgcgaaagaggtgtactcatcatcagacaattgtgtcttcttcttgaacctgctcatatttatcgtgtgatttgtgttctcttggaacgtgaatcgaaacataactttgcacaggaaatggtatcaactcttcatggcgttctactcactgccaccgaacttttcattttgagagatgaactgcgtgctctctccaacgaatcttcccgatcattattcgaatgcattttccgtgtttggtcaaatcgtccgattgctcttttgggactgtgtctactgtcacaacattatcaacaagcggctgatattgcacttcttctttctcaagttgatatcacagttgatgtactactggagattgacaaacttgtgaaccttgtcgagagtcctgttctcgcttgtaagttctttttttgatgtgaacaaaattcacattttgaccttgttgaagtgtaaataccgaatctattgttgattttttaaaagtcttcggtttcagatgttcgtatggaccttctttcgtcaattcatcgccctccactatgcacagttttatcagctcttttgatgcttctcccacaatctgaagcattcgtcaccctacataaacgtcttcaggcagttccggcactagtgtctattgagtaattatatttttctagaactttcaaaaaaataatatcaagtttcagtaactctccgtatgctccaaaagtcccaccatgcagaatcgacttcccaccattaatgctccatttcaaagcagctcttgctcgccgtcaaaccgaagttcgctcacgtcacagggatcttttatcgggagttgttacccaaatgaaaaatgtaaaaatctaattatttttgtatcttttcaagtttctactatttatttcttaatttatattattgccccaaaaatgtgatatattgccaacttgtattgtaagagggtaaatatgtgatagtatatgctcccactcgttaagtatttgtcaaataaagcgtactcaatagatcgaaagatcgtcctgttcctactgttagcaccagggatgg