Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.7   

sjj_K04G2.7RNAiJA:K04G2.7
PCR_productsjj_K04G2.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.7 Source_evidenceePCR614WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.7 Source_evidenceePCR614WS150 Sequence/Annotation Release
Chunk_score Abs_score511
Max_abs_score511K04G2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80474468048628
Overlaps_transcriptK04G2.7 Source_evidenceePCR614WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.71183tgagtcatcattgtttcgtcatccacttttaattttctctcgtcggctcttgtttaactatagaagcaccacacccattttggtcgaataaattgaaatagtgatgtggaaataaatagttaggagatgtaaccacttccattgaggtggctgatgattttatgtcctcgttggacgttgtttgtggcgttgatcttgtattttcttctggacttcttggctgaaatattgagttcagatcatataggaagtcattcaaagccacctttaactcgacacagtaacgacgtttgaatctgtaaagccagtttgcatcaaaaaattttgcaatatccggtatttctggatgcaactgataggcaacatattgagcatactccttgatccatggattcgttagacgctcgcctttattttggcgtctcacgatttctttattgacttgtaaatccacatcagcatattcctttcgactcgttcgcaatattcttcgttctacaaaaaaacaagtttaagctcatcaatcaatggattagaaaaaaaactgactcttcagaaagttagtcgtcttcatctttgttacatccaacgccgacagaattatcgtcttatcctttttgtcggcgtggcggcgtccactaaagtatctaaaaaacgaaagataaattatctaggtcatatagaagatgtagaagtcctcaccggattccatgtttcttccgaaacaaattaatccaccgatcagagacatcgaagccgcaaattctgcgaatctcacgcctcatccattcgtctccttaaaacacttttttttctatttaagttttcaaatttgattcaaatatattagttgatccttttatcaactttaggtattctatctgtgcttcgatatactacggtctaatttggaagccatatatgaacattataattacccatattgtgcagggtatatgttcacataatataaaaggcctgttcagttcaaaaagtatactccaaaatcattggaaagtcattttatgaatgaaaactgtcgtatctcatcactcaaattttcacacctcgttagttacagttctattcattccggtaaccctattgtgttgggacataagattcctgatgggaccacaaaaaagtggtggcgtgtttgctacccaacacaaatacccttgac