Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K04G2.9   

sjj_K04G2.9RNAiJA:K04G2.9
PCR_productsjj_K04G2.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G2.9 Source_evidenceePCR627WS150 Sequence/Annotation Release
Overlaps_Gene K04G2.8 Source_evidenceePCR5WS150 Sequence/Annotation Release
K04G2.9 Source_evidenceePCR627WS150 Sequence/Annotation Release
Chunk_score Abs_score543
Max_abs_score543K04G2.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI80554878057149
Overlaps_transcript K04G2.9 Source_evidenceePCR627WS150 Sequence/Annotation Release
K04G2.8b.2 Source_evidenceePCR5WS150 Sequence/Annotation Release
WB_DNA_textsjj_K04G2.91663tgttttattagaaatcggcaggaatgggagaaaaaaaaacacgagagaatcagttatattatgcaaactttcaaagaaaccattatcttcaatatagttcttctctggatatgttacgaagtgaatgacgattcttatgagtgaggaaggcagtcagtgcgtagaaaattcccaggatgaatgttaggaactgaaaaattaggttcataggttttttgagagttttttgttgaggaaaaatccagaagaaaaggagctagtggtggatagtttatctctttgtaacttttttgattttcgagttaagaataaattgttacccagacgtgaattttgcgatttttgcgccaaaagtacggtatctggtctcgacacgacgaattttttgtgaaatacaaaaggtgtgctattgtaatttcaaaatttatatcgatttttatagcttttcgttaaagacatattcgtttatcaaaaaaaactataaaaatcgatgaagtttgaaatacagtactctttaaaggagcacacccagttataactacccatggcgtgattactgtcttatagatgaaattatcaaaaacaaaattctaaatgcaagtaagccattatatgggcgtaccacctattcaaacttcaaactcacagatgcaaaagcccattcgtagataatccgacatccgttgtgaataattccatcggatccaatatcattgcaattgtttgaccaacttccagttgaataatatgcttcaacaattgacagtacaataaaaagaacagcacatatcacattgaacaaaagatcagcttcacgccaacagaagaaatcaagatgagagagatgaagagtaaagaaatatgcaataaggaagatgaatgtgagaagcattgccacgctggcaacagtcagaagaatcgtttgtccgaataaaattcctttgaatggtcctggaccgaagactgaagtgattagacatacaattaccacgcaaaggaactgaaaatgttttttaaacttaaatgatcttggagctgctaatttaattgttagtcaaacgtttacagtcagaaattattatagaaatgtaaaatttttctgataatctttttaaactaggttggaagtttcgtaagaagaccaatctgaaaatgtttacagcttccgcaacttccgaggcaatattttagcatatgtaactttcatcttcaaaagataaagtttcgaagcctttgccaaggacaatgaattgtttttttaaataaaaacttacaatttcggctattctcagcaaaccaagtggtcccagacaataattcttgtcagttggtccatgtccacatgaccacacactatgctccttgtacttggtcttttctctgaaatgtttaaataaattttaaatgtttgtccactagatcgtttgtaaaataattggatattgagtttccgaattcaatttgtttaccttgtagtcgtagtgacataagtaccatctggctgttgtgttgtataaacttcacgtcgatccatttctggaagaaattgttatatttgaatggataataatcatgaaaagtttaaaaggaatgtttaatatgaaagaagaaattatttcacggttggacgattatcaacgatttggaattgatgagtgaatgg