Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K05C4.1   

sjj_K05C4.1 RNAi JA:K05C4.1
Simmer:K05C4.1:Screen_A
Simmer:K05C4.1:Screen_B
PCR_productsjj_K05C4.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K05C4.1 Source_evidenceePCR937WS150 Sequence/Annotation Release
Chunk_score Abs_score874
Max_abs_score874K05C4.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1471927514720465
Overlaps_transcript K05C4.1.2 Source_evidenceePCR870WS150 Sequence/Annotation Release
K05C4.1.1 Source_evidenceePCR937WS150 Sequence/Annotation Release
WB_DNA_textsjj_K05C4.11191ggatcggatcagacatcaaatacatgtaagaagaataaaattaatttcagcgtagggaaattgaatcactcgactgggttgtaggtgatatctctgccgagctcatcggcaaactcgtaccacagcttgctcacgtccattggtggaagacgaatcttttcggttggcgtgatgtggcacactgaaatttggaggatgaaaaatagaagcgattagattaaaggtggccggagatttcacaaaatgaaccaattttttcatttatccgaagaattttttcgaataaaaatcgtctaaaatttaaattttagacaaaataaaagccatttttagtgaaaaatggtccattttgtggaatagccgagcaaaaagcttcacgtacaattgcagacgcctccggatccagaatcccgataagtggcgtgcatgatcgcacgcaggccgagctttctggcctcgtcgtccgtcatctttggcttgtagtgattatcgaggataccgtaggcattcagagatcctgagccaactgagcacactttaagctggcaacgatctccttccgagtcgactttgaagatttgtggtcccttcttatcgtatccggccaccatcgatccaactgacaatccttgtcctctgtatccatagagcgtatttgcaaagtacttgctcgcggcgctcacggtgattgaggtcttctcgcggagctcgtacaaactgaaaataaataattatttttgttttgaagctgaaaatattgaaactcacgtgcagtacttggcgacaattcgggtccagaactgacagtcagcagctcctccagccatcgtggcaaccatacgatctccgatgtccaagatcttcatgaccgacttggatgagatgtattcaccactggaggctcgtgaatcgacagccacaatgattcctcccttgtcagctggagttgctggctcgtagacgaacgccaatgtggtggttcctttgcggaattgcatggattttccggcggtctcggcgaagtgagtcttcatgaaatcgacgggctggattcccaacggaagcttcgcgaaagtgaaatcagctcgagccggctcggcgatcaggttctgcttggccattgccatctctccttcgtcattctcgaaatcgtcgaatgtctcgccccacatctttggagttcgattctga