Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K05C4.4   

sjj_K05C4.4RNAiJA:K05C4.4
PCR_productsjj_K05C4.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK05C4.4 Source_evidenceePCR960WS150 Sequence/Annotation Release
Overlaps_Gene K05C4.4 Source_evidenceePCR960WS150 Sequence/Annotation Release
Chunk_score Abs_score792
Max_abs_score792K05C4.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1473528314736477
Overlaps_transcriptK05C4.4 Source_evidenceePCR960WS150 Sequence/Annotation Release
WB_DNA_textsjj_K05C4.41195ggatgcccgctaataattcaggattttgatttgagtaggagatctccggagaaaaatgaaaaaaatatatataaacattccattttgcagaaatcaaacgtgatgtggagcctcccgcgaccgctgccgtgaaacgattaatatcgtttgccacaattccggcgtgttgtctgcattcaaaaggaaccggcccagatgcgcagttagcaaaccctttgaaaattacgataaaaattaagtttaatttcagatccgcggagaagtcagcgtcccatgcaattctcgacaagttctccgttattgtttcatctgattttcgcagccacctaataaattgtgcaaatgataacgaagtaaaggatttgattcctcaagttgcaccattttttgagcagctcaaggttgccatcgccgcagatttcatgtcgatcagcgaagttagaattttcctccgaaaattgttaaatttctcattttcagcttcacacgttcgatttgactgccaaagcgaaagctcgtggaaaagagctgatgacccgtgttcttcaaaatgtgaaggagtcgactattggctatgaaagaaatattctaaagaaggcttctgaaacagagagcgtatcttctcaaaaatctacacgaaatatctcgaacagtgtaatttttgaatttgaagctttagagatgcgtcaagatttggaaaagtcgatgaaaaaatgttttcatgattggaaaggagttgaaagagtcacatattcgaaaaccgacgaagttcttcgtgctcagctcttcacttcccacaattttagtgaaaaaaatcttgcggagaccattttgaaattgggtttcaaaactataaccgaatcagtgatcgttgacaaaaatgaattaaaatttgagacgctcgcatcggagattgcggaagtcggtcaatacgtctcaacggtacaagatatgtctggtaggtgtgaaaaccgtaatagcctgatgagaaaagttttcagtattggatgtaattaccgtgaacagattgcttgaagtccgcccggacacattggatgtgagcggattctgttttaatcttgaaatcttccgatcgatcaatctggaaggtattaaggtatgtcttggttgatcaaattttgaaatttgttttcttttccagaaattcactgcccgggaccattgcttgaacagt