Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06A4.5   

sjj_K06A4.5RNAiJA:K06A4.5
PCR_productsjj_K06A4.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06A4.5 Source_evidenceePCR767WS150 Sequence/Annotation Release
Overlaps_Gene K06A4.5 Source_evidenceePCR767WS150 Sequence/Annotation Release
Chunk_score Abs_score662
Max_abs_score662K06A4.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV95082509509443
Overlaps_transcriptK06A4.5 Source_evidenceePCR767WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06A4.51194tggcagaaccacctgtgataacaatgagcggagttactgcaattgagattccacaatggattcaagataatcaagaggattttgtaccacctgtttgtaacaagtgtatgttctcggatcagttgaaagttttctacgttggaggaccaaatcaaagaaaagattttcatttggaagaaggagaagagtttttcttccagagaaaaggggatatggtactgaaagtgattgaaaagggtcaagtccgtgatctagtaatcaagcaaggtaggattcatcacaaaatttatttttgaatttgtaaattaattaattaataacacaaactcacatggtttcttagataactttttaactagctttttaaattaaaattccatgaacaaaaaatttagactgaaaattgagaatttttcacaatttataaacggaaactaaatctgtgttgtcaaaaattttttggaattatttttttcacaaatgttagataatctgaatcaaaactcaaaattgagctctctatttttcaggggaaatgttcatgttgccagcaagagtagaacattcacctcaaagattttccaactctattggtcttgtcgttgaacgtgaacgaaagaatactgaatttgattgtgttcgatttcttgttggttcttccaatatcacactctttgaaagatggttctatttgactgatgttgtcaaggatttacctccattaatcaaagaattttatggatcgaatgaattcaaaactggttggtttgtagttgtgtgagctcaccgattttttgtttcaggtaaaccaggaaaaggaacatttgcatgcaatgctccatacgaagcaagatggactgatttacccgtacctattaatagaaaagaatttatctatgatcatatcagtgaagtgaagtaagaaattagttggttttgtttcggatagttaatttgagaagttttcagaaacggaccagtgagaatttatggagcacctgagtacaaaactgaagttatgttgctaggagagggatcttatgatttggaaagtggaactgtagagttgctaatttggttgcaggtatggcaaaaacagaaaaatcccaaaaaaaattcatgtatcatttaggaaaacacatttgcggtcgtagaagagagcgggttcacttatgcaatgaaatcggagaccat