Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06A5.1   

sjj_K06A5.1RNAiJA:K06A5.1
PCR_productsjj_K06A5.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06A5.1 Source_evidenceePCR1102WS150 Sequence/Annotation Release
Overlaps_Gene K06A5.1 Source_evidenceePCR1102WS150 Sequence/Annotation Release
Chunk_score Abs_score1060
Max_abs_score1060K06A5.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64750476476198
Overlaps_transcriptK06A5.1 Source_evidenceePCR1102WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06A5.11152agaccaccaactcaaatggcagagaatgaaacatcttcttgtatgaaaccacgggagaaaagcaccagatcacaagccgaagtctacctgcctccattgaaaaggtctcgctcaaaatgccaagtttcggctccacaaccttcaaactcttctcttcaactatctcaatgtatttcggaaagtgttccaagaagatcccgcacccgatgtagaacaactagtgatactactattgaagaagattccatgattgcattgtctgatccaaaaaatcacaattttatgcaaaataaaaacactgcttctggatcgcggaataagtcgacatctcaaatggggcgatctcagagcaaggcaagtgacgacgtcattatatcagaagtttctccaattgttactcggcgttcgcgttcaagaagccacgtgtcaagtctgatggaaaatccaccgccacttactcgaagcagatcgattccacagaaggcgacaacaatcccaactacacgttcacgttccagaggtcgctttgagttgtccggaaattccggtgcagagataagaattgaacgaaacttgccaagaccagttgaacaaagttcatcccgacatggccaatctcagagtgaagccattattgtatcagaagtgtcttctcgtcgttctcgttcaagatgccgtgtggcaagtctgaaagaaaccccaccgtcactttctacgaccagatctaaaccaattcaacaagagaagtcaatacgacatccacgttcacgttcgagaagtcgagttgtgctatctgaaaattcttgcgcagaaattataaaaaaaagaaatccaccaagatcaaaaagtgttgttggacgcccacaatccaacaacgaagacgagaaaaagaagaatcagaaagtaccaactagagtccgttctaaatcagtcagctacgaaatcagtaaactggttcgttttgatttgaatatttgtaaaaacattcatccttataattttaggtaccaaaccggcatgtttcacgagtaccgcctgatttttacgagatgcaaattctgtggactcagatttcggaaaagacaactcctactgaactttcagagtacaaatcgggccttcaaaaattgttgactggacgggtgtcttgtt