Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06A5.4   

sjj_K06A5.4 RNAi JA:K06A5.4
Simmer:K06A5.4:Screen_A
Simmer:K06A5.4:Screen_B
PF:GL1_2G7
PCR_productsjj_K06A5.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06A5.4 Source_evidenceePCR1014WS150 Sequence/Annotation Release
Overlaps_Gene K06A5.4 Source_evidenceePCR1014WS150 Sequence/Annotation Release
Chunk_score Abs_score930
Max_abs_score930K06A5.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI64615846462735
Overlaps_transcriptK06A5.4 Source_evidenceePCR1014WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06A5.41152gcgtgaagaacagcaaacaaaggaacgtgagagaagattagaagaagaaaaacaacgacgagatgctgaagctgaggctgaaagaaggcgaaaagaagaggaagagctggaagaagctaattacacccttcgtgctccgaaatctcagaacggcgagccaatcactccgataagattcacacggggacacgacaatggtggcgcgaaaaaagtattcatcttcgagcaaactccagtggtaagtaaaaatttatgttggaaacaatattttgtcatcttcagagaaaacaaggtcctattgcttcttcaacgcctcaacaaaaacaacggttggctgacggggccaataatcaaattccaccaacacaaaaatctcaagatagcgttcaagcggtacaaccaccaccaccgcgtccagctgcacggaatgctcagtttgcatcggatgcagacttgtttgcggttccaaaggctcctccatccaagagtgtacgtaacttagcagcttcgaatgtcgacatattcgcagatgttgactctgttcttgatacttttcattttgaaagcaccccaggacgggtacgaaaaccaggaaggcggaatgtatcatcaccatcaccagaaccacgccatcgttcttcatctagagacggttatgaacaatctcgatactctcagagatacgaacatgataacagtagatggagcagacataacgccacatatcgcagacacgaagatgaatcaagaatgagtagaaaaagagttcgtattaatcagttaatttgtcattggttttaaaattattacagagcatcgtgcgtgatgatttcgagtacagtcgccgtcatgacgatggtgcgaggcgtagagattattatgatgctgatatccaaggtgactcgaaacgataccgtggaagagacgcgtcttcttcttctggaagagtaagtaaaagaatatatgacgttttgaggacattcaataatttcagtctgttcgtttcgaagaagaacatcgtagacatggtgatgaatacagagatcctagaggacctcgtgattacaatgactatggcagacggcgaaatcatgcaaactccagaagtggcgaggacgaagaaaaattgaatgcgattgtacgtcgtgagaa