Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06B4.3   

sjj_K06B4.3 RNAi (5)
PCR_productsjj_K06B4.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06B4.3 Source_evidenceePCR252WS150 Sequence/Annotation Release
Overlaps_Gene K06B4.3 Source_evidenceePCR252WS150 Sequence/Annotation Release
Chunk_score Abs_score210
Max_abs_score210K06B4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1567483815675910
Overlaps_transcriptK06B4.3 Source_evidenceePCR252WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06B4.31073agcagtttcacaaagttttcagccgctccagctttcttaacactaaaactgattactgtcataggtaaaatgtagacatgtctagtgtagcgtagatatttatagttcaaaacagttcacattggtatttgattattggaataaaaacattaaaacctagtcaactgtggagttttccagttttttagttctagttactctaactgcttactttcatctaacaactgacatttcctattcaattgttgaaatctagcacctatcgttcctatttagagttcttttcgagcttattttacgaagtgtttaaagtctaaatttttttcacagaaaatccggcgactgcttttgaaccgtatttcatacacttgaaccttctgtgtaatatttatttgttcaaaatgaaatcgaatattattcagaatcattacttatattatcataagagttgttcgaattattaaaattgttgttcgaacggaagaggcaaccgcaacagcagcaacagcagcacacgatgaagacccccatcaaaatgtacacccaaatctgaaattaagacgattctttcaagctctttaaagctttttcaggatctgaagacctgagacgttacctcaagagcaatacagcattcgttggtgtcatcaccgcaacgatagtagtgatgggcaatcgatggcttaccgcacttatctccactaatgatttggaaaatagtatacagcaacattttcggcaacctgacaaactttcacgtccactccgtcgccggcgtccgagttgacaatcgcaaagatcacgatgatcacgcagaagatgagaaatttgagatttagcataatgagactctggaaaaatgattgatttttgcaaaatattgccgactagaactcacaaaatccaacgagaccgccgaatccgacaaagaaaataccgaagactgacttttcgaaattttatttttggaagcgaaacgtgtcatcagtggggttcaaggctatgacgatcagtgagaagtcacgattttttgaaagaaaaactgtgagaataaagaaaaatagagcccgtgc