Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06B4.8   

sjj_K06B4.8 RNAi JA:K06B4.8
Simmer:K06B4.8:Repeat_a
Simmer:K06B4.8:Screen
PCR_productsjj_K06B4.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06B4.8 Source_evidenceePCR703WS150 Sequence/Annotation Release
Overlaps_Gene K06B4.8 Source_evidenceePCR703WS150 Sequence/Annotation Release
Chunk_score Abs_score682
Max_abs_score682K06B4.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV1569691315698079
Overlaps_transcriptK06B4.8 Source_evidenceePCR703WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06B4.81167attaccctgggaaagttgggaaaatgaatgtgaaaaaaatctatatttcggaagcaaaataatttttaaagaaattacattttattttaaaaaatttgaatcgttatatttttggtaatttttcttttataggcattgacttgctccgcgtgcaagatgtttttccgaagatctgctgagaaaaaattgagctacaactgcaagaaggacaatcagtgctcaattgctcaacggaaatgccgagcttgtcgttttcaaaaatgcctgaactttggcatgacattttactcattccggggacaacttgctcaaaattttaataatctcgatcagaagctggagctccttttaaaagagctaacaataaaagatgggaaaaactacacaaaattcatcaactactactcaaatgaggacccttctttagtggatgttctaaaaaactcgaatgtgatgaaaatgaaaaagcggacacctcacaccgtcaccgattcccatgactgggcattcttggggatccatgcgaggatttcctattttatggatttcgagttcataaataagttgagtttgaatgacaaagtaatccttttcaaatacaatgctctacgcatgggatgtatgactgaagcaatgcgatgcttcactgcaaaaagagcatatttggtaactccaagcggtgaagatgtctacctgccgatatttcgtagaatattcgaaaagactccggcgcttttggatcagacatcttgcatggtgctttataagtttatagagttgaatattacaaatgaggagtgcattctattggcgctgattttcttttgcaatcctggtgagttctgcatagcaaaaatgaaggaaaaattgcttaaaacacagatttgagttgaaattttttcgccaagatatgttttgaaaaatttaagtttgaacctcctgcccaattttttaaggttataacttcgttcaagacaaaacttttcaaaatcaaaattaaaatttcggcgaaaaattgtttaaaaattgaaattttaatttggcaccaaagattttttgaacatttaaaaaagttttcagtcgaaactatttgacaaaaaaatgcaaaaaaaattaataccaatttttgttgaaaaattaaaatttggacttcccggccatattttt