Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06H7.1   

sjj_K06H7.1 RNAi JA:K06H7.1
Simmer:K06H7.1
PF:GL1_4E6
PCR_productsjj_K06H7.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC14B9.4b Source_evidenceePCR846WS150 Sequence/Annotation Release
Overlaps_Gene C14B9.4 Source_evidenceePCR846WS150 Sequence/Annotation Release
Chunk_score Abs_score740
Max_abs_score740C14B9.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII81012728102307
Overlaps_transcript (3)
WB_DNA_textsjj_K06H7.11036aatcgacttcccaacattgcaaaacccccacaaaagtccaaccaaagaaaggagaaggctccaccagaggttcccgctctcatcgccgacaaggatcgtgggacctattatgagaaaggacgatttttgggcaagggaggattcgctcactgttatgagcttacgaatcgagcaacacgcgaggttgtcgctggaaaagtggttccgaagtcgatgctcgtcaagcaataccagagagataaggtagacaatgaacgaatcttagttcagtgcatattacgatttttcagatgacacaagaggtgcagattcatcgagagcttggacacatcaatatcgtgaagttattcaacttcttcgaggacaatctcaacgtgtatatcactttggagttatgtgcaagacggtcgctgatggagttgcacaaaagaagaaaggcggtcaccgaacctgaagctcgttatttcactcatcaaattgtggatggcgtgctgtatttgcatgatctgaacatcattcatcgtgatatgaagcttggaaatcttttcctcaatgatgatctagttgtcaaaattggagatttcggattagcaacaacggtcaacggtgatgagagaaagaaaacgttgtgtggaacgccaaactacatagctccggaggttttgaacaaagctggacactcatttgaagttgacatttgggcagttggatgcattctgtacattcttcttttcggacaaccaccattcgagtctaaatcgcttgaagagacatactcacgcattcgccacaacaactacaccattccgtcgatcgcaacacaaccagcagcaagcctaatccgcaagatgcttgatcctgagccaacacgtcgtccgactgccaagcaggtaatttcaatagttttgaactggagtgaaaatcattttagtattatcggagattcgagtttcatcattagaaaatttgtacttttgaattttatcgtgaacttttattgagagatagttcacgttcagtttgattgcccttcgtt