Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K06H7.4   

sjj_K06H7.4 RNAi JA:K06H7.4
PF:GL1_8A5
PCR_productsjj_K06H7.4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K06H7.4 Source_evidenceePCR742WS150 Sequence/Annotation Release
Chunk_score Abs_score658
Max_abs_score658K06H7.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80857968086990
Overlaps_transcript K06H7.4.2 Source_evidenceePCR742WS150 Sequence/Annotation Release
K06H7.4.1 Source_evidenceePCR742WS150 Sequence/Annotation Release
WB_DNA_textsjj_K06H7.41195ggaaggcacaacttgtcgatgaaattgaggcgctaaaaaatgaggtgtgaaaactaattagttttaatgaatgttttagccaaacaaaaatctttagaacggaaatcttcacttttctattttaaataatatttttcaaaattatattaatcaattctctgtgatgccttttacggttttgtttttgcattctaaaaatttagatttttgttataaatatcgaagaatatttctaataactgaaactttgataagctatctttgatttctaaaaaaaacaataaatttaaaaaagcaaaatgacgttctccatgtgtgctattttaaattctgtctattacgaaatatgtcaacatattaggtacgagaagttgacgaagaactcgatcaagtatattacacccatccaaaatcaaaagaatatcacaaaatagtggtgaatggccgaaaaaagttcaatcaagacccatggaaagcgttggattggttggcatcaagaaatgtagttgcaaaggatcctcaagcattggcgctctggatgaaagctgtgagttttcttattttttaaaacaattatttaatagaaatctatttattatgttttcaactgcaatttttcagggcgaaggactttctaaaagtgcgatcggcgaaatactgggtgataaccgtccatttgcgttggaaacccttgacagattcacaaaagaacataaattgcatgatgttccgattgttccagctcttcgtcaatatctattttccttccggctacctggcgaatcgcagaaaattaatcgaattttggagaaatttgcagaagtttacgcgaatcaaaatccatcatatggaaatgcagatcaagcacatacagtagcatattcatgtattatggttaatacattattacataatccaaacgttaaagataaaccatcactggaaaaatatattgaaatgaatgaggttggtataggatgaaaattgaagaaaaaacatttttaatgaaattaaatggaaaatttcagcaacttctcgaaaaaggtgcaattacaatcgaacagctcacagaagtatatgaatcagttagtgttacacaattcaagatcccagatgaagtatcgacaagtggaaaaggaactgtgaacgatattctattacatgctgaacgagaaggatggcttttcaagcagag