Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.3   

sjj_K07A1.3RNAiJA:K07A1.3
PCR_productsjj_K07A1.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK07A1.3 Source_evidenceePCR348WS150 Sequence/Annotation Release
Overlaps_Gene K07A1.3 Source_evidenceePCR455WS150 Sequence/Annotation Release
Chunk_score Abs_score413
Max_abs_score413K07A1.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI95874059588164
Overlaps_transcriptK07A1.3 Source_evidenceePCR455WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.3760ttttccttgataaccaatgatcgcaatttcgtcggtttcagccaccgtctccctcgtctcgacaaacccgtccacttcttgcttttttacgaatccacactgagtgaatattttcagttgagagaatcaattaatgtacctacagcgagcaaccaatgagcagagtgtcctctcacataaacgggctgataattgggaccacaatcgtatgcaatcaacatctgtttcccatcacaaatggattgagtaaattcttttggggaaggcatttttcgaattttggaagaatttggcaggaattcatttgtgagagaagccagtgattcagctgaatatggataatcaattgaactctttaaattataactcaccagagtacatttctccttgtttcgtgaaacccatctctttggctttttcgagtattgtctcgggattagttttgatcccgaaatgttccaagcacatagatatggctacaaggccgcacctgaatactttcatagttcaaaatcacttataatatttacgttggccctttctgctgccttggagtgattttatttgtatttaaacaaacttgtcctccaaattctcccgtgaagcttgtcaatcgtatttgtgtgatcataggaagtgattgaaagtcgaatgcattgtccattctaaactacagcataaatcgatactagatattgtatatctacatgtggtcccttttgttcattgctcagggcgaccgaggaaaaactagtccatt