Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.8   

sjj_K07A1.8RNAiJA:K07A1.8
PCR_productsjj_K07A1.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K07A1.8 Source_evidenceePCR928WS150 Sequence/Annotation Release
Chunk_score Abs_score823
Max_abs_score823K07A1.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96104599611623
Overlaps_transcript K07A1.8.1 Source_evidenceePCR928WS150 Sequence/Annotation Release
K07A1.8.2 Source_evidenceePCR877WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.81165tgctccttgaatttggctctctcctgttcatattctttcatctgcctctcgaactcttcatcatatttttgtttctcttgttgtggaatctgctcagcaactggcactggtttctgttgctcgttgaaaagagagaatacagagaagtccaaaacgtcgtggtcatcagcaagaccgccggtagcagcagaaacgccgaagtatccattacgtggaaggaagatgttttcagcacgcatacaaagctcgtaacgaggtgttggttgcataccatcgtcaatatgaactgtgagtacattcttcaaatattcgattcgaatgcgaactggatatggcttattacggaaatctcgttggcaacctgaaaaatatgttggtttggtgatttttctttagaaaacttactagacaaaatctgttgtgatccatcggtatgatgatcatatgatctggttccatcattcagcataagagacacctgtgggttgttcttttggccatcgttgtcgaacgaatcgaggaacaatcccatacccgtccagaaatcgtttcctccgaaaactggtccaagggctccaagttgagaagtgtaccagattccgagaccatctgctccgacacgtccctgtcctccaattttcagagcgatgtctacctgcaaatgtgttttttttttggatatttttcttagaaactcacctggaagttttcactttctaagaaagctctcttgttccacgcaataccttttctgcttctcattgatggagccaatcggagctgttcaccagaagcaatagcatctccactaacctaaatctcacgctttttgattaaaaaattggagaattattttcttacaatccagaaaggaatagatccatcgcgttgtgcaagatttggagcacggaaagaatgcttgtattcgaacctgtaaattaaagaggaaattacttcaaggtttttaaactttaaaaacctacttcttgaaaaccggagtattttgtgcttgaatggtaacgattacggccagcagcacgagtagaacccgtgatgaggtcatatctggaatgcaaatgtttgcttagcgaatgaaaatgcaaatatcgtgagaaaattttggagaaatgaaggaaaaactgtagagaaactcggcataagccaa