Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_K07A1.9   

sjj_K07A1.9RNAiJA:K07A1.9
PCR_productsjj_K07A1.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K07A1.9a Source_evidenceePCR714WS150 Sequence/Annotation Release
K07A1.9b Source_evidenceePCR714WS150 Sequence/Annotation Release
Overlaps_Gene K07A1.9 Source_evidenceePCR714WS150 Sequence/Annotation Release
Chunk_score Abs_score630
Max_abs_score630K07A1.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI96121509613302
Overlaps_transcript K07A1.9b Source_evidenceePCR714WS150 Sequence/Annotation Release
K07A1.9c Source_evidenceePCR714WS150 Sequence/Annotation Release
K07A1.9a Source_evidenceePCR714WS150 Sequence/Annotation Release
WB_DNA_textsjj_K07A1.91153catttgagcaagttgagccatcaaggagatcacgacatgaattaaaatcaacccatcgaaacgattggtcacaaagaagatcacttgggcgaaatttagccttgtagcgcatttttggacacgagtgaatgtagtatcccatatagtaatacttgagattcgaataaattgcatgaagacgttgagtttgctcgatttctctgtaattacaatttatgattgaaaaaaaacgaaggatatgcccacctcaaagctgtatatgttcccagggacaaaaatgaatattccggattataatacatgtatttggccgaaaaacattttggtagaatatcaacgacacaaacagcaatcagtttatcatctagaagaaaccaaagatggaatgagcccagctctattctgaaattgaactcattttttaagagtaactggcgaattccctaaaagctacattttgtgattttttctccaaaaatacggtaccaggtctcatcacggcaaaatttgttgaacccaaaacgcgcgcctttaaagggtactgaaattttaaaatttcgttgttggggagtttttatcgaattttaataggtttcctcactcacgatatgttaaaattcatgctctttgttgttgttgagttaaaggcaccgttttgtacttaacaaaacatttttcgtgtcgagaccttgtattttttgcgtaaaaatcgcaaaatttcgcgttcggggtaataatagctcaccctcctctttgctcttttttcaatggagaatcacagaggaatctacgaaaaccggcaagtcgacagtcttcgtctttgtgaatagtatgctggtaatttttgtacaattcgaatgattcgttatctcttgttccaaattcatctccaccgagagaaactagttttacttcgagtttatgtttccagtcaggacgagcttcatcgatgtacgattgaattgttcgttgacgagctgcatctttttgacgacgttcggttcggacaacatcgggatccaaattcttttgacgacatttttcttcaaatctgtaaattgaaattattaattattaaactaaatattggaaaaagtctactttttattgcgaatttccttttttgtcaaaacgggtctatccgcatctttca